Mutagenetix > Incidental Mutations

Incidental Mutation 'R0620:Ints6'

58627

Institutional Source

Beutler Lab

Gene Symbol

Ints6

Ensembl Gene

ENSMUSG00000035161

Gene Name

integrator complex subunit 6

Synonyms

DICE1, Notch2l, Ddx26, 2900075H24Rik

MMRRC Submission

038809-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R0620 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

62676330-62761169 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 62696759 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Phenylalanine to Leucine at position 766 (F766L)

Ref Sequence

ENSEMBL: ENSMUSP00000152954 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000053959] [ENSMUST00000171692] [ENSMUST00000223585]

AlphaFold

Q6PCM2

Predicted Effect

probably benign
Transcript: ENSMUST00000053959
AA Change: F766L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000086788
Gene: ENSMUSG00000035161
AA Change: F766L

Domain	Start	End	E-Value	Type
VWA	1	158	4.11e-1	SMART
Blast:VWA	307	331	1e-7	BLAST
Blast:RRM_2	701	727	3e-8	BLAST
Pfam:INT_SG_DDX_CT_C	803	865	4e-30	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000171692

SMART Domains

Protein: ENSMUSP00000125769
Gene: ENSMUSG00000091155

Domain	Start	End	E-Value	Type
signal peptide	1	21	N/A	INTRINSIC
SERPIN	37	399	4.76e-58	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000223585
AA Change: F766L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

Meta Mutation Damage Score

0.0581

Coding Region Coverage

1x: 99.4%
3x: 99.0%
10x: 97.8%
20x: 96.1%

Validation Efficiency

100% (74/74)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] DEAD box proteins, characterized by the conserved motif Asp-Glu-Ala-Asp (DEAD), are putative RNA helicases. The protein encoded by this gene is a DEAD box protein that is part of a complex that interacts with the C-terminus of RNA polymerase II and is involved in 3' end processing of snRNAs. In addition, this gene is a candidate tumor suppressor and is located in the critical region of loss of heterozygosity (LOH). Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Apr 2015]
PHENOTYPE: Mice homozygous for a transgenic gene disruption exhibit embryonic lethality at E7. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 72 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2810474O19Rik	A	T	6: 149,328,375	Q973L	probably damaging	Het
Adamts9	T	C	6: 92,858,113	T679A	possibly damaging	Het
Ahr	T	C	12: 35,508,194	T276A	probably benign	Het
Akap9	A	T	5: 4,064,136	Q3138H	probably damaging	Het
Armt1	T	A	10: 4,432,689	F7I	probably benign	Het
B3galt2	A	G	1: 143,646,140	R5G	probably damaging	Het
Bod1l	T	C	5: 41,801,233	N2750S	probably benign	Het
Cadps2	T	A	6: 23,583,396	E365V	probably damaging	Het
Cd200r3	T	A	16: 44,957,717		probably null	Het
Cst7	T	A	2: 150,575,886		probably benign	Het
Defb30	A	T	14: 63,049,763		probably benign	Het
Dido1	C	T	2: 180,659,851	G2087S	probably benign	Het
Dio2	A	G	12: 90,738,071	Y72H	probably benign	Het
Dnah11	C	T	12: 117,987,469	E3035K	probably damaging	Het
Dnajb13	T	C	7: 100,503,249	K287E	possibly damaging	Het
Dnajc11	G	A	4: 151,973,628	V244I	possibly damaging	Het
Ect2	C	T	3: 27,139,652	A226T	probably damaging	Het
Ercc8	G	A	13: 108,174,061		probably null	Het
Fam120b	T	A	17: 15,402,927	M389K	probably benign	Het
Fam151a	A	G	4: 106,747,931	M497V	probably benign	Het
Fam186b	C	A	15: 99,280,128	G439V	probably benign	Het
Fank1	A	G	7: 133,876,765	Y185C	probably damaging	Het
Gart	T	C	16: 91,630,602		probably benign	Het
Glb1l	T	C	1: 75,199,720	Y572C	probably damaging	Het
Gm11563	C	T	11: 99,658,437	A164T	unknown	Het
Gnb4	C	T	3: 32,591,207	V112I	probably benign	Het
Gsdmc3	T	A	15: 63,859,693	D330V	probably damaging	Het
H2-DMa	C	T	17: 34,137,960	T144M	probably damaging	Het
Haus6	A	T	4: 86,583,514	F707I	possibly damaging	Het
Hmcn1	T	A	1: 150,594,016	T4971S	probably benign	Het
Kdm5d	T	A	Y: 927,330	M650K	probably damaging	Het
Kif21b	T	C	1: 136,159,428	F881S	possibly damaging	Het
Klrk1	C	A	6: 129,614,635	Q176H	possibly damaging	Het
Ky	T	C	9: 102,537,621	V244A	probably benign	Het
Mia2	T	A	12: 59,154,419	L191M	possibly damaging	Het
Miga2	T	A	2: 30,381,744		probably benign	Het
Mtss1l	C	T	8: 110,737,948	P322S	probably damaging	Het
Nalcn	A	G	14: 123,299,141		probably benign	Het
Ncbp3	T	A	11: 73,049,845		probably benign	Het
Nprl3	G	A	11: 32,234,876	L378F	probably damaging	Het
Ntrk2	A	T	13: 58,846,821	M184L	probably benign	Het
Olfr311	T	G	11: 58,841,443	C110G	probably damaging	Het
Olfr738	G	T	14: 50,413,697	C51F	probably benign	Het
Osbpl9	T	C	4: 109,083,128	E287G	probably damaging	Het
Parva	T	C	7: 112,576,411	F250L	probably damaging	Het
Pcdhb11	C	T	18: 37,421,811	Q65*	probably null	Het
Phtf1	A	G	3: 103,993,765	T377A	probably damaging	Het
Pkp4	G	A	2: 59,322,643	V612I	possibly damaging	Het
Plscr2	C	A	9: 92,287,654	S52R	probably benign	Het
Pnisr	C	T	4: 21,874,092		probably benign	Het
Pole2	A	C	12: 69,209,879	S291A	probably damaging	Het
Ppp2r5d	A	G	17: 46,684,018	F586L	probably benign	Het
Prrx1	G	A	1: 163,257,816	R182C	probably damaging	Het
Ptprs	A	G	17: 56,429,103	I110T	possibly damaging	Het
Rasgrf2	G	A	13: 91,919,817		probably benign	Het
Riox2	T	C	16: 59,491,892	V464A	probably benign	Het
Robo2	A	G	16: 73,967,802	V646A	possibly damaging	Het
Ros1	T	A	10: 52,118,348	I1279F	probably damaging	Het
Siglec1	G	A	2: 131,074,268	T1254M	probably benign	Het
Snx7	T	C	3: 117,846,675	N62D	probably damaging	Het
Sp100	G	A	1: 85,659,867		probably null	Het
Stil	A	T	4: 115,007,159	I86L	possibly damaging	Het
Tbc1d16	T	A	11: 119,209,038	D170V	probably benign	Het
Tmem2	T	A	19: 21,817,971	S743T	probably benign	Het
Trappc13	G	A	13: 104,161,081	T105M	probably damaging	Het
Trhr	T	A	15: 44,229,500	S378T	probably benign	Het
Ttc7b	T	C	12: 100,500,073		probably null	Het
Vegfc	A	T	8: 54,157,139	Y110F	probably benign	Het
Vmn1r184	C	A	7: 26,267,177	P116H	possibly damaging	Het
Vmn2r5	A	T	3: 64,503,814	C444*	probably null	Het
Zfp341	A	G	2: 154,634,273	E460G	possibly damaging	Het
Zfp819	T	A	7: 43,616,444	V41E	probably benign	Het

Other mutations in Ints6

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00535:Ints6	APN	14	62703179	missense	probably damaging	1.00
IGL00763:Ints6	APN	14	62700865	splice site	probably benign
IGL01624:Ints6	APN	14	62696871	missense	probably benign	0.07
IGL01721:Ints6	APN	14	62713739	missense	probably damaging	0.96
IGL02146:Ints6	APN	14	62759260	missense	possibly damaging	0.91
G1Funyon:Ints6	UTSW	14	62702453	missense	probably benign
R0302:Ints6	UTSW	14	62709512	missense	probably damaging	1.00
R0320:Ints6	UTSW	14	62707635	nonsense	probably null
R0543:Ints6	UTSW	14	62696611	missense	probably damaging	1.00
R0554:Ints6	UTSW	14	62704751	missense	possibly damaging	0.87
R0960:Ints6	UTSW	14	62709566	missense	probably benign	0.39
R1216:Ints6	UTSW	14	62707698	missense	probably damaging	1.00
R1254:Ints6	UTSW	14	62716374	missense	probably benign	0.27
R1296:Ints6	UTSW	14	62704903	splice site	probably benign
R1548:Ints6	UTSW	14	62713692	missense	probably damaging	1.00
R1944:Ints6	UTSW	14	62693640	missense	probably benign	0.03
R2040:Ints6	UTSW	14	62713689	missense	probably damaging	0.99
R2279:Ints6	UTSW	14	62704682	critical splice donor site	probably null
R2844:Ints6	UTSW	14	62704826	missense	probably damaging	0.97
R3107:Ints6	UTSW	14	62760592	missense	possibly damaging	0.92
R3407:Ints6	UTSW	14	62696937	missense	probably benign	0.00
R3895:Ints6	UTSW	14	62696611	missense	probably damaging	1.00
R4608:Ints6	UTSW	14	62703229	missense	probably damaging	1.00
R4903:Ints6	UTSW	14	62702462	missense	probably damaging	1.00
R4964:Ints6	UTSW	14	62702462	missense	probably damaging	1.00
R4966:Ints6	UTSW	14	62702462	missense	probably damaging	1.00
R5014:Ints6	UTSW	14	62760191	missense	probably benign	0.00
R5369:Ints6	UTSW	14	62743935	missense	probably damaging	1.00
R6478:Ints6	UTSW	14	62700786	missense	probably benign	0.37
R7022:Ints6	UTSW	14	62714337	missense	probably damaging	1.00
R7403:Ints6	UTSW	14	62707655	missense	possibly damaging	0.50
R7422:Ints6	UTSW	14	62704775	missense	probably benign
R7909:Ints6	UTSW	14	62759330	missense	probably damaging	0.99
R8147:Ints6	UTSW	14	62713737	missense	probably damaging	1.00
R8301:Ints6	UTSW	14	62702453	missense	probably benign
R8496:Ints6	UTSW	14	62705876	missense	probably benign	0.06
R8502:Ints6	UTSW	14	62760579	missense	possibly damaging	0.92
R8514:Ints6	UTSW	14	62695717	missense	possibly damaging	0.89
R8540:Ints6	UTSW	14	62696904	missense	probably benign	0.39
R8733:Ints6	UTSW	14	62696848	missense	probably benign	0.01
R8810:Ints6	UTSW	14	62702453	missense	probably benign	0.02
R8839:Ints6	UTSW	14	62693673	missense	probably benign	0.06
R9057:Ints6	UTSW	14	62714291	critical splice donor site	probably null
R9178:Ints6	UTSW	14	62709587	missense	probably damaging	1.00
R9318:Ints6	UTSW	14	62696698	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- GTTAGAACAGTCAAGATTCTGTGCCCC -3'
(R):5'- CATGTTGCTGACCAACTTTCATCAGAC -3'

Sequencing Primer
(F):5'- GATAAAGACTTTCTGCTATCTACCAC -3'
(R):5'- CATGACACCAAATGCTATGGATACTG -3'

Posted On

2013-07-11