Incidental Mutation 'R0620:Trhr'
ID 58629
Institutional Source Beutler Lab
Gene Symbol Trhr
Ensembl Gene ENSMUSG00000038760
Gene Name thyrotropin releasing hormone receptor
Synonyms TRH-R1
MMRRC Submission 038809-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R0620 (G1)
Quality Score 225
Status Validated
Chromosome 15
Chromosomal Location 44196135-44235912 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 44229500 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Threonine at position 378 (S378T)
Ref Sequence ENSEMBL: ENSMUSP00000154650 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038856] [ENSMUST00000110289] [ENSMUST00000226626] [ENSMUST00000227505]
AlphaFold P21761
Predicted Effect probably benign
Transcript: ENSMUST00000038856
AA Change: S378T

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000036320
Gene: ENSMUSG00000038760
AA Change: S378T

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srx 33 177 1.6e-7 PFAM
Pfam:7TM_GPCR_Srsx 36 335 4.8e-12 PFAM
Pfam:7tm_1 42 320 1.6e-50 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000110289
AA Change: S378T

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000105918
Gene: ENSMUSG00000038760
AA Change: S378T

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srx 33 175 1.9e-7 PFAM
Pfam:7TM_GPCR_Srsx 36 335 4.8e-12 PFAM
Pfam:7tm_1 42 320 1.3e-58 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000226626
AA Change: S378T

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
Predicted Effect probably benign
Transcript: ENSMUST00000227505
Meta Mutation Damage Score 0.0877 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 99.0%
  • 10x: 97.8%
  • 20x: 96.1%
Validation Efficiency 100% (74/74)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a G protein-coupled receptor for thyrotropin-releasing hormone (TRH). Upon binding to TRH, this receptor activates the inositol phospholipid-calcium-protein kinase C transduction pathway. Mutations in this gene have been associated with generalized thyrotropin-releasing hormone resistance. [provided by RefSeq, Sep 2011]
PHENOTYPE: Homozygous null mice are fertile and display decreased thyroxine, triiodothyronine, and prolactin levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810474O19Rik A T 6: 149,328,375 Q973L probably damaging Het
Adamts9 T C 6: 92,858,113 T679A possibly damaging Het
Ahr T C 12: 35,508,194 T276A probably benign Het
Akap9 A T 5: 4,064,136 Q3138H probably damaging Het
Armt1 T A 10: 4,432,689 F7I probably benign Het
B3galt2 A G 1: 143,646,140 R5G probably damaging Het
Bod1l T C 5: 41,801,233 N2750S probably benign Het
Cadps2 T A 6: 23,583,396 E365V probably damaging Het
Cd200r3 T A 16: 44,957,717 probably null Het
Cst7 T A 2: 150,575,886 probably benign Het
Defb30 A T 14: 63,049,763 probably benign Het
Dido1 C T 2: 180,659,851 G2087S probably benign Het
Dio2 A G 12: 90,738,071 Y72H probably benign Het
Dnah11 C T 12: 117,987,469 E3035K probably damaging Het
Dnajb13 T C 7: 100,503,249 K287E possibly damaging Het
Dnajc11 G A 4: 151,973,628 V244I possibly damaging Het
Ect2 C T 3: 27,139,652 A226T probably damaging Het
Ercc8 G A 13: 108,174,061 probably null Het
Fam120b T A 17: 15,402,927 M389K probably benign Het
Fam151a A G 4: 106,747,931 M497V probably benign Het
Fam186b C A 15: 99,280,128 G439V probably benign Het
Fank1 A G 7: 133,876,765 Y185C probably damaging Het
Gart T C 16: 91,630,602 probably benign Het
Glb1l T C 1: 75,199,720 Y572C probably damaging Het
Gm11563 C T 11: 99,658,437 A164T unknown Het
Gnb4 C T 3: 32,591,207 V112I probably benign Het
Gsdmc3 T A 15: 63,859,693 D330V probably damaging Het
H2-DMa C T 17: 34,137,960 T144M probably damaging Het
Haus6 A T 4: 86,583,514 F707I possibly damaging Het
Hmcn1 T A 1: 150,594,016 T4971S probably benign Het
Ints6 A T 14: 62,696,759 F766L probably benign Het
Kdm5d T A Y: 927,330 M650K probably damaging Het
Kif21b T C 1: 136,159,428 F881S possibly damaging Het
Klrk1 C A 6: 129,614,635 Q176H possibly damaging Het
Ky T C 9: 102,537,621 V244A probably benign Het
Mia2 T A 12: 59,154,419 L191M possibly damaging Het
Miga2 T A 2: 30,381,744 probably benign Het
Mtss1l C T 8: 110,737,948 P322S probably damaging Het
Nalcn A G 14: 123,299,141 probably benign Het
Ncbp3 T A 11: 73,049,845 probably benign Het
Nprl3 G A 11: 32,234,876 L378F probably damaging Het
Ntrk2 A T 13: 58,846,821 M184L probably benign Het
Olfr311 T G 11: 58,841,443 C110G probably damaging Het
Olfr738 G T 14: 50,413,697 C51F probably benign Het
Osbpl9 T C 4: 109,083,128 E287G probably damaging Het
Parva T C 7: 112,576,411 F250L probably damaging Het
Pcdhb11 C T 18: 37,421,811 Q65* probably null Het
Phtf1 A G 3: 103,993,765 T377A probably damaging Het
Pkp4 G A 2: 59,322,643 V612I possibly damaging Het
Plscr2 C A 9: 92,287,654 S52R probably benign Het
Pnisr C T 4: 21,874,092 probably benign Het
Pole2 A C 12: 69,209,879 S291A probably damaging Het
Ppp2r5d A G 17: 46,684,018 F586L probably benign Het
Prrx1 G A 1: 163,257,816 R182C probably damaging Het
Ptprs A G 17: 56,429,103 I110T possibly damaging Het
Rasgrf2 G A 13: 91,919,817 probably benign Het
Riox2 T C 16: 59,491,892 V464A probably benign Het
Robo2 A G 16: 73,967,802 V646A possibly damaging Het
Ros1 T A 10: 52,118,348 I1279F probably damaging Het
Siglec1 G A 2: 131,074,268 T1254M probably benign Het
Snx7 T C 3: 117,846,675 N62D probably damaging Het
Sp100 G A 1: 85,659,867 probably null Het
Stil A T 4: 115,007,159 I86L possibly damaging Het
Tbc1d16 T A 11: 119,209,038 D170V probably benign Het
Tmem2 T A 19: 21,817,971 S743T probably benign Het
Trappc13 G A 13: 104,161,081 T105M probably damaging Het
Ttc7b T C 12: 100,500,073 probably null Het
Vegfc A T 8: 54,157,139 Y110F probably benign Het
Vmn1r184 C A 7: 26,267,177 P116H possibly damaging Het
Vmn2r5 A T 3: 64,503,814 C444* probably null Het
Zfp341 A G 2: 154,634,273 E460G possibly damaging Het
Zfp819 T A 7: 43,616,444 V41E probably benign Het
Other mutations in Trhr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01596:Trhr APN 15 44229312 missense probably damaging 1.00
IGL01800:Trhr APN 15 44229207 missense possibly damaging 0.69
IGL01945:Trhr APN 15 44197144 missense probably damaging 0.99
IGL02608:Trhr APN 15 44197678 missense probably benign 0.08
IGL02825:Trhr APN 15 44229525 missense possibly damaging 0.62
pushover UTSW 15 44197627 missense probably damaging 1.00
P4717OSA:Trhr UTSW 15 44197435 missense probably damaging 0.97
R0007:Trhr UTSW 15 44229151 splice site probably benign
R0276:Trhr UTSW 15 44197086 start codon destroyed probably null 0.74
R1563:Trhr UTSW 15 44197101 missense probably benign 0.05
R1728:Trhr UTSW 15 44197153 missense probably damaging 1.00
R1729:Trhr UTSW 15 44197153 missense probably damaging 1.00
R2144:Trhr UTSW 15 44197183 missense probably benign 0.44
R2167:Trhr UTSW 15 44229242 missense probably damaging 1.00
R3965:Trhr UTSW 15 44197699 missense possibly damaging 0.70
R4246:Trhr UTSW 15 44233460 critical splice acceptor site probably null
R4272:Trhr UTSW 15 44197224 missense probably damaging 0.97
R4378:Trhr UTSW 15 44197627 missense probably damaging 1.00
R4618:Trhr UTSW 15 44197641 missense probably benign 0.00
R5093:Trhr UTSW 15 44197584 missense probably damaging 0.96
R5388:Trhr UTSW 15 44197477 missense possibly damaging 0.91
R5496:Trhr UTSW 15 44197536 missense probably benign 0.00
R6341:Trhr UTSW 15 44229298 nonsense probably null
R6463:Trhr UTSW 15 44197585 missense probably benign 0.09
R6575:Trhr UTSW 15 44229206 missense possibly damaging 0.83
R7483:Trhr UTSW 15 44229231 missense probably damaging 1.00
R8780:Trhr UTSW 15 44197753 missense possibly damaging 0.84
R8807:Trhr UTSW 15 44197816 missense probably benign 0.00
R8897:Trhr UTSW 15 44197340 missense probably benign 0.00
Y5406:Trhr UTSW 15 44197641 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TCTCCAGCCCTTTCCAGGAAAATTG -3'
(R):5'- AAAGCCAAGCCTCCCTGTGATG -3'

Sequencing Primer
(F):5'- CCAGGAAAATTGGTTCTTGCTC -3'
(R):5'- TGTGATGCCTCCAGTGCAAG -3'
Posted On 2013-07-11