Incidental Mutation 'R7575:Wdr49'
ID586309
Institutional Source Beutler Lab
Gene Symbol Wdr49
Ensembl Gene ENSMUSG00000104301
Gene NameWD repeat domain 49
SynonymsEG213248
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.089) question?
Stock #R7575 (G1)
Quality Score225.009
Status Not validated
Chromosome3
Chromosomal Location75274988-75482156 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 75450886 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 184 (M184K)
Ref Sequence ENSEMBL: ENSMUSP00000145379 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000193989] [ENSMUST00000203169] [ENSMUST00000204341]
Predicted Effect probably benign
Transcript: ENSMUST00000193989
SMART Domains Protein: ENSMUSP00000144721
Gene: ENSMUSG00000104301

DomainStartEndE-ValueType
WD40 17 55 1.3e-2 SMART
WD40 59 98 2e-6 SMART
WD40 145 184 2.5e-2 SMART
WD40 187 228 3.6e-8 SMART
WD40 281 318 8.7e-6 SMART
WD40 365 412 2.2e-1 SMART
WD40 415 455 8.4e-4 SMART
WD40 471 512 3.1e-2 SMART
Blast:SERPIN 608 673 7e-12 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000203169
AA Change: M247K

PolyPhen 2 Score 0.962 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000144789
Gene: ENSMUSG00000104301
AA Change: M247K

DomainStartEndE-ValueType
WD40 136 176 2e-1 SMART
WD40 178 224 1.8e0 SMART
WD40 312 353 5.1e-1 SMART
WD40 358 396 1.3e-2 SMART
WD40 400 439 2e-6 SMART
Blast:WD40 486 511 1e-7 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000204341
AA Change: M184K

PolyPhen 2 Score 0.962 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000145379
Gene: ENSMUSG00000104301
AA Change: M184K

DomainStartEndE-ValueType
WD40 73 113 3.18e1 SMART
WD40 115 161 2.74e2 SMART
WD40 249 290 7.92e1 SMART
WD40 295 333 1.99e0 SMART
WD40 337 376 3.05e-4 SMART
Blast:WD40 423 448 1e-7 BLAST
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the WD repeat protein family with nine WD repeats. WD repeats are minimally conserved regions of approximately 40 amino acids typically bracketed by gly-his and trp-asp (GH-WD), which may facilitate formation of heterotrimeric or multiprotein complexes. Members of this family are involved in a variety of cellular processes, including cell cycle progression, signal transduction, apoptosis, and gene regulation. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2017]
Allele List at MGI
Other mutations in this stock
Total: 91 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3425401B19Rik C T 14: 32,662,632 V459I probably benign Het
4921539E11Rik T C 4: 103,230,995 D439G probably damaging Het
Adam18 T C 8: 24,625,857 N607S possibly damaging Het
Adamtsl3 A T 7: 82,574,548 N1179I possibly damaging Het
Adarb1 A G 10: 77,303,295 F552S probably damaging Het
Ago1 T C 4: 126,453,908 E394G probably benign Het
Alb G A 5: 90,465,929 C224Y probably damaging Het
Alms1 T A 6: 85,622,159 H1322Q possibly damaging Het
Arhgef18 T G 8: 3,451,635 V643G probably damaging Het
Asah2 T C 19: 32,016,703 Q414R probably benign Het
Bbc3 G A 7: 16,312,367 R76H possibly damaging Het
BC027072 T A 17: 71,750,855 Q609L probably damaging Het
Bub1b T A 2: 118,641,158 S1000T possibly damaging Het
Bud23 A T 5: 135,061,128 Y70* probably null Het
C1d A G 11: 17,262,694 E13G probably damaging Het
Camk1 T A 6: 113,338,364 I158F probably damaging Het
Ccr2 A C 9: 124,105,806 D41A probably benign Het
Cdh18 G T 15: 23,400,597 E348* probably null Het
Col6a3 A G 1: 90,810,599 L1066P possibly damaging Het
Cyp11b1 T A 15: 74,839,313 D172V probably benign Het
Cyp2j8 A G 4: 96,470,548 I378T possibly damaging Het
Cys1 T A 12: 24,668,648 K69* probably null Het
Dip2c A G 13: 9,628,012 K1165E probably damaging Het
Drd3 A T 16: 43,817,133 I232F probably benign Het
Dusp7 T C 9: 106,373,677 C334R probably damaging Het
Eppk1 A G 15: 76,111,242 S480P not run Het
Erc1 G T 6: 119,824,760 P99T possibly damaging Het
Fam170b C T 14: 32,836,198 P330L unknown Het
Fam173b C T 15: 31,606,040 A48V probably damaging Het
Fasn G T 11: 120,812,687 T1573K possibly damaging Het
Fras1 A T 5: 96,543,314 T130S probably benign Het
Fzd4 A G 7: 89,407,710 I322V possibly damaging Het
Gbp10 G A 5: 105,236,149 probably benign Het
Gdpd4 A T 7: 97,998,241 H365L probably benign Het
Gfy A G 7: 45,178,100 S191P probably benign Het
Ghr A T 15: 3,320,512 S395T probably damaging Het
Git2 C T 5: 114,766,489 R123H probably damaging Het
Htt A G 5: 34,905,643 D2873G probably damaging Het
Idua A T 5: 108,681,699 D476V probably damaging Het
Inppl1 G A 7: 101,828,482 R683W probably damaging Het
Ipp T C 4: 116,532,644 S466P probably benign Het
Iqgap2 A G 13: 95,661,623 V1058A probably damaging Het
Jmy A T 13: 93,464,595 Y434* probably null Het
Kmt2d CTGCTGCTG CTGCTGCTGATGCTGCTG 15: 98,849,611 probably benign Het
Mogs T G 6: 83,115,835 S85R probably damaging Het
Mroh2b A T 15: 4,934,605 D863V probably damaging Het
Mtmr10 A T 7: 64,297,465 I43F probably damaging Het
Mtr T C 13: 12,199,077 D903G probably benign Het
Ncor1 A G 11: 62,383,256 V186A probably benign Het
Notch3 C T 17: 32,154,819 D472N possibly damaging Het
Olfr1062 A G 2: 86,423,238 F146S probably benign Het
Olfr1294 A T 2: 111,538,252 F12L probably damaging Het
Olfr1502 T C 19: 13,862,017 S75P probably damaging Het
Olfr780 T C 10: 129,321,859 F79L probably damaging Het
Oxr1 T G 15: 41,823,362 L547V possibly damaging Het
Pappa2 A T 1: 158,814,530 C1319S probably damaging Het
Papss1 A C 3: 131,643,096 K623N probably damaging Het
Parp4 T C 14: 56,637,918 F1198S probably benign Het
Pcnt A T 10: 76,389,252 V1806D probably benign Het
Pitx2 A T 3: 129,215,726 H98L probably damaging Het
Polq C A 16: 37,091,134 D2410E probably benign Het
Prdm9 C T 17: 15,544,628 C630Y probably damaging Het
Preb A T 5: 30,958,495 D201E probably damaging Het
Rasa3 A T 8: 13,595,887 I151N possibly damaging Het
Rasgrp2 T A 19: 6,404,367 S147T probably damaging Het
Rev3l A G 10: 39,821,445 D646G possibly damaging Het
Sdc1 A G 12: 8,790,619 E128G probably damaging Het
Slamf7 A C 1: 171,639,194 C148G probably damaging Het
Slc19a2 T C 1: 164,257,122 S194P probably damaging Het
Spata31 C T 13: 64,922,912 P958L unknown Het
Sprr2b CTGAGCCTTGTCCTCCTCCAAAGTGCCCTGAGCCTTGTCCTCCCCCAGTATGCTGTGAGCCTTGTCCTCCTCCAAAGTGCCCTGAGCCTTGTCCTCCCCCAGTATGCTGTGAGCCTTGTCCTCC CTGAGCCTTGTCCTCCTCCAAAGTGCCCTGAGCCTTGTCCTCCCCCAGTATGCTGTGAGCCTTGTCCTCC 3: 92,317,519 probably benign Het
Stradb A G 1: 58,988,580 I90V probably benign Het
Tas2r134 A G 2: 51,628,154 D215G probably damaging Het
Tbc1d4 T C 14: 101,447,589 K1209E probably damaging Het
Thbs1 A G 2: 118,122,928 D942G probably damaging Het
Tmem107 C T 11: 69,072,807 P139S probably benign Het
Tmem216 A T 19: 10,551,902 M40K probably benign Het
Tpte A G 8: 22,355,482 Y516C probably damaging Het
Trim54 G A 5: 31,134,087 G184D possibly damaging Het
Try5 A T 6: 41,311,814 L157Q probably benign Het
Ubqlnl G A 7: 104,148,490 A600V probably damaging Het
Uhrf2 C A 19: 30,071,368 P258Q probably damaging Het
Ush2a A T 1: 188,822,688 E3554D possibly damaging Het
Usp40 A C 1: 87,949,960 L1158W probably damaging Het
Vmn1r121 T A 7: 21,098,273 R81* probably null Het
Vmn1r203 C A 13: 22,524,418 T123K probably benign Het
Vmn2r101 T C 17: 19,611,392 V550A probably benign Het
Wipi2 A G 5: 142,658,232 N123S probably damaging Het
Zbtb14 T C 17: 69,387,447 F47L probably damaging Het
Zc3h7b C A 15: 81,777,885 S385* probably null Het
Zhx2 T A 15: 57,823,262 F676I probably damaging Het
Other mutations in Wdr49
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0266:Wdr49 UTSW 3 75451796 missense possibly damaging 0.80
R0432:Wdr49 UTSW 3 75450022 missense possibly damaging 0.70
R0599:Wdr49 UTSW 3 75431076 splice site probably null
R0599:Wdr49 UTSW 3 75449890 splice site probably null
R0948:Wdr49 UTSW 3 75450851 missense probably benign 0.06
R1341:Wdr49 UTSW 3 75429333 missense probably damaging 1.00
R1526:Wdr49 UTSW 3 75396920 missense probably benign 0.03
R1593:Wdr49 UTSW 3 75396941 missense probably benign 0.00
R1603:Wdr49 UTSW 3 75396870 nonsense probably null
R1874:Wdr49 UTSW 3 75429347 missense probably damaging 1.00
R2986:Wdr49 UTSW 3 75382040 missense probably benign 0.11
R3013:Wdr49 UTSW 3 75450847 missense probably damaging 0.96
R3025:Wdr49 UTSW 3 75333356 missense possibly damaging 0.94
R4027:Wdr49 UTSW 3 75323665 missense probably benign 0.05
R4029:Wdr49 UTSW 3 75323665 missense probably benign 0.05
R4030:Wdr49 UTSW 3 75323665 missense probably benign 0.05
R4031:Wdr49 UTSW 3 75323665 missense probably benign 0.05
R4578:Wdr49 UTSW 3 75335243 missense probably benign 0.00
R6024:Wdr49 UTSW 3 75301826 missense probably benign 0.02
R6141:Wdr49 UTSW 3 75323682 missense probably benign
R6172:Wdr49 UTSW 3 75298180 missense probably damaging 1.00
R6263:Wdr49 UTSW 3 75481517 missense possibly damaging 0.84
R6501:Wdr49 UTSW 3 75339458 missense probably benign 0.01
R6584:Wdr49 UTSW 3 75337758 missense probably benign 0.01
R6698:Wdr49 UTSW 3 75429366 missense probably benign 0.01
R6891:Wdr49 UTSW 3 75333283 synonymous probably null
R7202:Wdr49 UTSW 3 75333273 missense probably benign 0.11
R7214:Wdr49 UTSW 3 75358444 missense possibly damaging 0.63
R7572:Wdr49 UTSW 3 75358437 missense possibly damaging 0.94
R7673:Wdr49 UTSW 3 75450907 missense probably damaging 1.00
R7790:Wdr49 UTSW 3 75275028 missense probably benign 0.16
Z1176:Wdr49 UTSW 3 75451533 missense probably damaging 1.00
Z1177:Wdr49 UTSW 3 75449903 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTAGCTCTCTAACAATGGAAATCCC -3'
(R):5'- AGGGCTCTCAGAGAACTGTC -3'

Sequencing Primer
(F):5'- TCCCACAAATCAAAACAAGTACTTTG -3'
(R):5'- CAGTGGCTTTTACAAGCAG -3'
Posted On2019-10-24