Incidental Mutation 'R7575:Ago1'
ID 586316
Institutional Source Beutler Lab
Gene Symbol Ago1
Ensembl Gene ENSMUSG00000041530
Gene Name argonaute RISC catalytic subunit 1
Synonyms Eif2c1, argonaute 1
MMRRC Submission
Accession Numbers
Essential gene? Probably essential (E-score: 0.811) question?
Stock # R7575 (G1)
Quality Score 225.009
Status Not validated
Chromosome 4
Chromosomal Location 126435012-126468583 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 126453908 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 394 (E394G)
Ref Sequence ENSEMBL: ENSMUSP00000095498 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000097888] [ENSMUST00000176315]
AlphaFold Q8CJG1
Predicted Effect probably benign
Transcript: ENSMUST00000097888
AA Change: E394G

PolyPhen 2 Score 0.122 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000095498
Gene: ENSMUSG00000041530
AA Change: E394G

DomainStartEndE-ValueType
Pfam:ArgoN 26 164 2.3e-26 PFAM
DUF1785 173 225 3.48e-25 SMART
PAZ 233 368 1.41e-5 SMART
Pfam:ArgoL2 373 418 3.6e-18 PFAM
Pfam:ArgoMid 427 509 7.6e-37 PFAM
Piwi 515 816 4.16e-131 SMART
Blast:Piwi 823 849 3e-6 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000127800
Predicted Effect possibly damaging
Transcript: ENSMUST00000176315
AA Change: E87G

PolyPhen 2 Score 0.693 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000134871
Gene: ENSMUSG00000041530
AA Change: E87G

DomainStartEndE-ValueType
Pfam:PAZ 1 62 4.1e-23 PFAM
Piwi 211 512 4.16e-131 SMART
Blast:Piwi 519 545 2e-6 BLAST
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the argonaute family of proteins, which associate with small RNAs and have important roles in RNA interference (RNAi) and RNA silencing. This protein binds to microRNAs (miRNAs) or small interfering RNAs (siRNAs) and represses translation of mRNAs that are complementary to them. It is also involved in transcriptional gene silencing (TGS) of promoter regions that are complementary to bound short antigene RNAs (agRNAs), as well as in the degradation of miRNA-bound mRNA targets. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. A recent study showed this gene to be an authentic stop codon readthrough target, and that its mRNA could give rise to an additional C-terminally extended isoform by use of an alternative in-frame translation termination codon. [provided by RefSeq, Nov 2015]
PHENOTYPE: Mice homozygous for a conditional allele activated in keratinocytes exhibit no abnormal phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 91 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3425401B19Rik C T 14: 32,662,632 V459I probably benign Het
4921539E11Rik T C 4: 103,230,995 D439G probably damaging Het
Adam18 T C 8: 24,625,857 N607S possibly damaging Het
Adamtsl3 A T 7: 82,574,548 N1179I possibly damaging Het
Adarb1 A G 10: 77,303,295 F552S probably damaging Het
Alb G A 5: 90,465,929 C224Y probably damaging Het
Alms1 T A 6: 85,622,159 H1322Q possibly damaging Het
Arhgef18 T G 8: 3,451,635 V643G probably damaging Het
Asah2 T C 19: 32,016,703 Q414R probably benign Het
Bbc3 G A 7: 16,312,367 R76H possibly damaging Het
BC027072 T A 17: 71,750,855 Q609L probably damaging Het
Bub1b T A 2: 118,641,158 S1000T possibly damaging Het
Bud23 A T 5: 135,061,128 Y70* probably null Het
C1d A G 11: 17,262,694 E13G probably damaging Het
Camk1 T A 6: 113,338,364 I158F probably damaging Het
Ccr2 A C 9: 124,105,806 D41A probably benign Het
Cdh18 G T 15: 23,400,597 E348* probably null Het
Col6a3 A G 1: 90,810,599 L1066P possibly damaging Het
Cyp11b1 T A 15: 74,839,313 D172V probably benign Het
Cyp2j8 A G 4: 96,470,548 I378T possibly damaging Het
Cys1 T A 12: 24,668,648 K69* probably null Het
Dip2c A G 13: 9,628,012 K1165E probably damaging Het
Drd3 A T 16: 43,817,133 I232F probably benign Het
Dusp7 T C 9: 106,373,677 C334R probably damaging Het
Eppk1 A G 15: 76,111,242 S480P not run Het
Erc1 G T 6: 119,824,760 P99T possibly damaging Het
Fam170b C T 14: 32,836,198 P330L unknown Het
Fam173b C T 15: 31,606,040 A48V probably damaging Het
Fasn G T 11: 120,812,687 T1573K possibly damaging Het
Fras1 A T 5: 96,543,314 T130S probably benign Het
Fzd4 A G 7: 89,407,710 I322V possibly damaging Het
Gbp10 G A 5: 105,236,149 probably benign Het
Gdpd4 A T 7: 97,998,241 H365L probably benign Het
Gfy A G 7: 45,178,100 S191P probably benign Het
Ghr A T 15: 3,320,512 S395T probably damaging Het
Git2 C T 5: 114,766,489 R123H probably damaging Het
Htt A G 5: 34,905,643 D2873G probably damaging Het
Idua A T 5: 108,681,699 D476V probably damaging Het
Inppl1 G A 7: 101,828,482 R683W probably damaging Het
Ipp T C 4: 116,532,644 S466P probably benign Het
Iqgap2 A G 13: 95,661,623 V1058A probably damaging Het
Jmy A T 13: 93,464,595 Y434* probably null Het
Kmt2d CTGCTGCTG CTGCTGCTGATGCTGCTG 15: 98,849,611 probably benign Het
Mogs T G 6: 83,115,835 S85R probably damaging Het
Mroh2b A T 15: 4,934,605 D863V probably damaging Het
Mtmr10 A T 7: 64,297,465 I43F probably damaging Het
Mtr T C 13: 12,199,077 D903G probably benign Het
Ncor1 A G 11: 62,383,256 V186A probably benign Het
Notch3 C T 17: 32,154,819 D472N possibly damaging Het
Olfr1062 A G 2: 86,423,238 F146S probably benign Het
Olfr1294 A T 2: 111,538,252 F12L probably damaging Het
Olfr1502 T C 19: 13,862,017 S75P probably damaging Het
Olfr780 T C 10: 129,321,859 F79L probably damaging Het
Oxr1 T G 15: 41,823,362 L547V possibly damaging Het
Pappa2 A T 1: 158,814,530 C1319S probably damaging Het
Papss1 A C 3: 131,643,096 K623N probably damaging Het
Parp4 T C 14: 56,637,918 F1198S probably benign Het
Pcnt A T 10: 76,389,252 V1806D probably benign Het
Pitx2 A T 3: 129,215,726 H98L probably damaging Het
Polq C A 16: 37,091,134 D2410E probably benign Het
Prdm9 C T 17: 15,544,628 C630Y probably damaging Het
Preb A T 5: 30,958,495 D201E probably damaging Het
Rasa3 A T 8: 13,595,887 I151N possibly damaging Het
Rasgrp2 T A 19: 6,404,367 S147T probably damaging Het
Rev3l A G 10: 39,821,445 D646G possibly damaging Het
Sdc1 A G 12: 8,790,619 E128G probably damaging Het
Slamf7 A C 1: 171,639,194 C148G probably damaging Het
Slc19a2 T C 1: 164,257,122 S194P probably damaging Het
Spata31 C T 13: 64,922,912 P958L unknown Het
Sprr2b CTGAGCCTTGTCCTCCTCCAAAGTGCCCTGAGCCTTGTCCTCCCCCAGTATGCTGTGAGCCTTGTCCTCCTCCAAAGTGCCCTGAGCCTTGTCCTCCCCCAGTATGCTGTGAGCCTTGTCCTCC CTGAGCCTTGTCCTCCTCCAAAGTGCCCTGAGCCTTGTCCTCCCCCAGTATGCTGTGAGCCTTGTCCTCC 3: 92,317,519 probably benign Het
Stradb A G 1: 58,988,580 I90V probably benign Het
Tas2r134 A G 2: 51,628,154 D215G probably damaging Het
Tbc1d4 T C 14: 101,447,589 K1209E probably damaging Het
Thbs1 A G 2: 118,122,928 D942G probably damaging Het
Tmem107 C T 11: 69,072,807 P139S probably benign Het
Tmem216 A T 19: 10,551,902 M40K probably benign Het
Tpte A G 8: 22,355,482 Y516C probably damaging Het
Trim54 G A 5: 31,134,087 G184D possibly damaging Het
Try5 A T 6: 41,311,814 L157Q probably benign Het
Ubqlnl G A 7: 104,148,490 A600V probably damaging Het
Uhrf2 C A 19: 30,071,368 P258Q probably damaging Het
Ush2a A T 1: 188,822,688 E3554D possibly damaging Het
Usp40 A C 1: 87,949,960 L1158W probably damaging Het
Vmn1r121 T A 7: 21,098,273 R81* probably null Het
Vmn1r203 C A 13: 22,524,418 T123K probably benign Het
Vmn2r101 T C 17: 19,611,392 V550A probably benign Het
Wdr49 A T 3: 75,450,886 M184K probably damaging Het
Wipi2 A G 5: 142,658,232 N123S probably damaging Het
Zbtb14 T C 17: 69,387,447 F47L probably damaging Het
Zc3h7b C A 15: 81,777,885 S385* probably null Het
Zhx2 T A 15: 57,823,262 F676I probably damaging Het
Other mutations in Ago1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01377:Ago1 APN 4 126459817 missense probably damaging 0.98
IGL02578:Ago1 APN 4 126439531 missense probably benign 0.12
IGL02709:Ago1 APN 4 126453640 nonsense probably null
IGL02810:Ago1 APN 4 126443093 missense probably benign 0.00
IGL03037:Ago1 APN 4 126461794 missense probably benign 0.00
IGL03091:Ago1 APN 4 126459189 missense probably damaging 0.98
IGL03100:Ago1 APN 4 126443171 missense probably benign 0.08
IGL03121:Ago1 APN 4 126460003 missense probably benign 0.00
R0195:Ago1 UTSW 4 126463691 missense probably benign 0.01
R0244:Ago1 UTSW 4 126463706 missense possibly damaging 0.94
R0309:Ago1 UTSW 4 126443166 missense probably benign 0.06
R0514:Ago1 UTSW 4 126439595 missense probably benign
R0557:Ago1 UTSW 4 126460024 missense probably benign 0.00
R1104:Ago1 UTSW 4 126453633 missense probably damaging 0.99
R1553:Ago1 UTSW 4 126440401 missense probably damaging 0.99
R1624:Ago1 UTSW 4 126463741 missense probably damaging 0.97
R1851:Ago1 UTSW 4 126439995 missense probably benign 0.00
R1867:Ago1 UTSW 4 126441236 missense probably damaging 0.98
R2001:Ago1 UTSW 4 126454394 missense probably null 0.36
R2051:Ago1 UTSW 4 126460453 missense probably benign 0.01
R2057:Ago1 UTSW 4 126443228 missense probably damaging 0.98
R2105:Ago1 UTSW 4 126461788 missense probably benign 0.30
R2117:Ago1 UTSW 4 126463857 splice site probably null
R2256:Ago1 UTSW 4 126441911 missense possibly damaging 0.80
R2272:Ago1 UTSW 4 126453650 missense probably benign 0.01
R2517:Ago1 UTSW 4 126439939 nonsense probably null
R2850:Ago1 UTSW 4 126443075 splice site probably benign
R2993:Ago1 UTSW 4 126440046 splice site probably benign
R3746:Ago1 UTSW 4 126461044 missense probably benign
R3747:Ago1 UTSW 4 126461044 missense probably benign
R3750:Ago1 UTSW 4 126461044 missense probably benign
R4600:Ago1 UTSW 4 126460392 missense probably benign 0.37
R4934:Ago1 UTSW 4 126448859 missense possibly damaging 0.56
R4983:Ago1 UTSW 4 126453654 missense probably damaging 0.99
R5086:Ago1 UTSW 4 126453604 missense probably benign 0.01
R5132:Ago1 UTSW 4 126461723 missense probably benign 0.01
R5239:Ago1 UTSW 4 126441215 missense probably damaging 1.00
R5609:Ago1 UTSW 4 126461037 missense possibly damaging 0.80
R5705:Ago1 UTSW 4 126448794 missense probably benign 0.01
R5980:Ago1 UTSW 4 126460569 unclassified probably benign
R6036:Ago1 UTSW 4 126443228 missense probably damaging 0.98
R6036:Ago1 UTSW 4 126443228 missense probably damaging 0.98
R6398:Ago1 UTSW 4 126448808 missense probably benign 0.26
R6505:Ago1 UTSW 4 126463835 missense probably benign 0.00
R6545:Ago1 UTSW 4 126454352 missense possibly damaging 0.74
R6944:Ago1 UTSW 4 126460422 missense possibly damaging 0.78
R7041:Ago1 UTSW 4 126463706 missense possibly damaging 0.94
R7490:Ago1 UTSW 4 126439505 makesense probably null
R7496:Ago1 UTSW 4 126461752 missense probably benign 0.20
R7625:Ago1 UTSW 4 126443229 missense probably benign 0.18
R7988:Ago1 UTSW 4 126460417 missense probably damaging 1.00
R8041:Ago1 UTSW 4 126441936 missense probably damaging 1.00
R8073:Ago1 UTSW 4 126443226 missense probably benign 0.04
R8086:Ago1 UTSW 4 126460981 missense probably benign
R8127:Ago1 UTSW 4 126454421 missense possibly damaging 0.95
R8772:Ago1 UTSW 4 126460523 unclassified probably benign
R8878:Ago1 UTSW 4 126463723 missense probably benign 0.35
R8989:Ago1 UTSW 4 126463790 missense probably benign 0.01
R9140:Ago1 UTSW 4 126443184 missense probably benign
X0025:Ago1 UTSW 4 126443115 missense possibly damaging 0.47
Z1177:Ago1 UTSW 4 126453656 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCCTCAGTAGAGCCTTGTG -3'
(R):5'- TGCTTCTTGGGCTATTAGCTAC -3'

Sequencing Primer
(F):5'- CCTCAGTAGAGCCTTGTGAGGAG -3'
(R):5'- TGGGCTATTAGCTACTTCTTTCTC -3'
Posted On 2019-10-24