Incidental Mutation 'R0620:Cd200r3'
ID 58632
Institutional Source Beutler Lab
Gene Symbol Cd200r3
Ensembl Gene ENSMUSG00000036172
Gene Name CD200 receptor 3
Synonyms 4833409J19Rik, mCD200RLb, 4733401I18Rik
MMRRC Submission 038809-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.062) question?
Stock # R0620 (G1)
Quality Score 225
Status Validated
Chromosome 16
Chromosomal Location 44943678-44981380 bp(+) (GRCm38)
Type of Mutation splice site
DNA Base Change (assembly) T to A at 44957717 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000132938 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048479] [ENSMUST00000048479] [ENSMUST00000048479] [ENSMUST00000048479] [ENSMUST00000077178] [ENSMUST00000077178] [ENSMUST00000077178] [ENSMUST00000077178] [ENSMUST00000114611] [ENSMUST00000114611] [ENSMUST00000114611] [ENSMUST00000114611] [ENSMUST00000114612] [ENSMUST00000114612] [ENSMUST00000114612] [ENSMUST00000114612] [ENSMUST00000114613] [ENSMUST00000114613] [ENSMUST00000114613] [ENSMUST00000114613] [ENSMUST00000114622] [ENSMUST00000114622] [ENSMUST00000114622] [ENSMUST00000114622] [ENSMUST00000164007] [ENSMUST00000164007] [ENSMUST00000164007] [ENSMUST00000164007] [ENSMUST00000166731] [ENSMUST00000166731] [ENSMUST00000166731] [ENSMUST00000166731] [ENSMUST00000171779] [ENSMUST00000171779] [ENSMUST00000171779] [ENSMUST00000171779]
AlphaFold Q5UKY4
Predicted Effect probably null
Transcript: ENSMUST00000048479
SMART Domains Protein: ENSMUSP00000036624
Gene: ENSMUSG00000036172

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
low complexity region 33 49 N/A INTRINSIC
PDB:4BFI|A 58 238 1e-42 PDB
Blast:IG 65 163 1e-21 BLAST
Blast:IG_like 165 270 8e-32 BLAST
Predicted Effect probably null
Transcript: ENSMUST00000048479
SMART Domains Protein: ENSMUSP00000036624
Gene: ENSMUSG00000036172

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
low complexity region 33 49 N/A INTRINSIC
PDB:4BFI|A 58 238 1e-42 PDB
Blast:IG 65 163 1e-21 BLAST
Blast:IG_like 165 270 8e-32 BLAST
Predicted Effect probably null
Transcript: ENSMUST00000048479
SMART Domains Protein: ENSMUSP00000036624
Gene: ENSMUSG00000036172

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
low complexity region 33 49 N/A INTRINSIC
PDB:4BFI|A 58 238 1e-42 PDB
Blast:IG 65 163 1e-21 BLAST
Blast:IG_like 165 270 8e-32 BLAST
Predicted Effect probably null
Transcript: ENSMUST00000048479
SMART Domains Protein: ENSMUSP00000036624
Gene: ENSMUSG00000036172

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
low complexity region 33 49 N/A INTRINSIC
PDB:4BFI|A 58 238 1e-42 PDB
Blast:IG 65 163 1e-21 BLAST
Blast:IG_like 165 270 8e-32 BLAST
Predicted Effect probably null
Transcript: ENSMUST00000077178
SMART Domains Protein: ENSMUSP00000076421
Gene: ENSMUSG00000036172

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
low complexity region 33 49 N/A INTRINSIC
PDB:4BFI|A 58 163 1e-12 PDB
Blast:IG 65 163 2e-22 BLAST
transmembrane domain 171 193 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000077178
SMART Domains Protein: ENSMUSP00000076421
Gene: ENSMUSG00000036172

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
low complexity region 33 49 N/A INTRINSIC
PDB:4BFI|A 58 163 1e-12 PDB
Blast:IG 65 163 2e-22 BLAST
transmembrane domain 171 193 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000077178
SMART Domains Protein: ENSMUSP00000076421
Gene: ENSMUSG00000036172

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
low complexity region 33 49 N/A INTRINSIC
PDB:4BFI|A 58 163 1e-12 PDB
Blast:IG 65 163 2e-22 BLAST
transmembrane domain 171 193 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000077178
SMART Domains Protein: ENSMUSP00000076421
Gene: ENSMUSG00000036172

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
low complexity region 33 49 N/A INTRINSIC
PDB:4BFI|A 58 163 1e-12 PDB
Blast:IG 65 163 2e-22 BLAST
transmembrane domain 171 193 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000114611
SMART Domains Protein: ENSMUSP00000110258
Gene: ENSMUSG00000036172

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
low complexity region 33 49 N/A INTRINSIC
PDB:4BFI|A 58 238 9e-43 PDB
Blast:IG 65 163 1e-21 BLAST
Blast:IG_like 165 273 2e-32 BLAST
Predicted Effect probably null
Transcript: ENSMUST00000114611
SMART Domains Protein: ENSMUSP00000110258
Gene: ENSMUSG00000036172

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
low complexity region 33 49 N/A INTRINSIC
PDB:4BFI|A 58 238 9e-43 PDB
Blast:IG 65 163 1e-21 BLAST
Blast:IG_like 165 273 2e-32 BLAST
Predicted Effect probably null
Transcript: ENSMUST00000114611
SMART Domains Protein: ENSMUSP00000110258
Gene: ENSMUSG00000036172

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
low complexity region 33 49 N/A INTRINSIC
PDB:4BFI|A 58 238 9e-43 PDB
Blast:IG 65 163 1e-21 BLAST
Blast:IG_like 165 273 2e-32 BLAST
Predicted Effect probably null
Transcript: ENSMUST00000114611
SMART Domains Protein: ENSMUSP00000110258
Gene: ENSMUSG00000036172

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
low complexity region 33 49 N/A INTRINSIC
PDB:4BFI|A 58 238 9e-43 PDB
Blast:IG 65 163 1e-21 BLAST
Blast:IG_like 165 273 2e-32 BLAST
Predicted Effect probably null
Transcript: ENSMUST00000114612
SMART Domains Protein: ENSMUSP00000110259
Gene: ENSMUSG00000036172

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
low complexity region 33 49 N/A INTRINSIC
PDB:4BFI|A 58 163 8e-13 PDB
Blast:IG 65 163 2e-22 BLAST
transmembrane domain 171 193 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000114612
SMART Domains Protein: ENSMUSP00000110259
Gene: ENSMUSG00000036172

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
low complexity region 33 49 N/A INTRINSIC
PDB:4BFI|A 58 163 8e-13 PDB
Blast:IG 65 163 2e-22 BLAST
transmembrane domain 171 193 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000114612
SMART Domains Protein: ENSMUSP00000110259
Gene: ENSMUSG00000036172

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
low complexity region 33 49 N/A INTRINSIC
PDB:4BFI|A 58 163 8e-13 PDB
Blast:IG 65 163 2e-22 BLAST
transmembrane domain 171 193 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000114612
SMART Domains Protein: ENSMUSP00000110259
Gene: ENSMUSG00000036172

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
low complexity region 33 49 N/A INTRINSIC
PDB:4BFI|A 58 163 8e-13 PDB
Blast:IG 65 163 2e-22 BLAST
transmembrane domain 171 193 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000114613
SMART Domains Protein: ENSMUSP00000110260
Gene: ENSMUSG00000036172

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
low complexity region 33 49 N/A INTRINSIC
PDB:4BFI|A 58 238 9e-43 PDB
Blast:IG 65 163 1e-21 BLAST
Blast:IG_like 165 274 2e-32 BLAST
Predicted Effect probably null
Transcript: ENSMUST00000114613
SMART Domains Protein: ENSMUSP00000110260
Gene: ENSMUSG00000036172

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
low complexity region 33 49 N/A INTRINSIC
PDB:4BFI|A 58 238 9e-43 PDB
Blast:IG 65 163 1e-21 BLAST
Blast:IG_like 165 274 2e-32 BLAST
Predicted Effect probably null
Transcript: ENSMUST00000114613
SMART Domains Protein: ENSMUSP00000110260
Gene: ENSMUSG00000036172

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
low complexity region 33 49 N/A INTRINSIC
PDB:4BFI|A 58 238 9e-43 PDB
Blast:IG 65 163 1e-21 BLAST
Blast:IG_like 165 274 2e-32 BLAST
Predicted Effect probably null
Transcript: ENSMUST00000114613
SMART Domains Protein: ENSMUSP00000110260
Gene: ENSMUSG00000036172

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
low complexity region 33 49 N/A INTRINSIC
PDB:4BFI|A 58 238 9e-43 PDB
Blast:IG 65 163 1e-21 BLAST
Blast:IG_like 165 274 2e-32 BLAST
Predicted Effect probably null
Transcript: ENSMUST00000114622
SMART Domains Protein: ENSMUSP00000110269
Gene: ENSMUSG00000036172

DomainStartEndE-ValueType
Pfam:V-set 22 164 6.9e-6 PFAM
transmembrane domain 171 193 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000114622
SMART Domains Protein: ENSMUSP00000110269
Gene: ENSMUSG00000036172

DomainStartEndE-ValueType
Pfam:V-set 22 164 6.9e-6 PFAM
transmembrane domain 171 193 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000114622
SMART Domains Protein: ENSMUSP00000110269
Gene: ENSMUSG00000036172

DomainStartEndE-ValueType
Pfam:V-set 22 164 6.9e-6 PFAM
transmembrane domain 171 193 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000114622
SMART Domains Protein: ENSMUSP00000110269
Gene: ENSMUSG00000036172

DomainStartEndE-ValueType
Pfam:V-set 22 164 6.9e-6 PFAM
transmembrane domain 171 193 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000164007
SMART Domains Protein: ENSMUSP00000130480
Gene: ENSMUSG00000036172

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
low complexity region 33 49 N/A INTRINSIC
PDB:4BFI|A 58 238 1e-42 PDB
Blast:IG 65 163 1e-21 BLAST
Blast:IG_like 165 273 2e-32 BLAST
Predicted Effect probably null
Transcript: ENSMUST00000164007
SMART Domains Protein: ENSMUSP00000130480
Gene: ENSMUSG00000036172

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
low complexity region 33 49 N/A INTRINSIC
PDB:4BFI|A 58 238 1e-42 PDB
Blast:IG 65 163 1e-21 BLAST
Blast:IG_like 165 273 2e-32 BLAST
Predicted Effect probably null
Transcript: ENSMUST00000164007
SMART Domains Protein: ENSMUSP00000130480
Gene: ENSMUSG00000036172

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
low complexity region 33 49 N/A INTRINSIC
PDB:4BFI|A 58 238 1e-42 PDB
Blast:IG 65 163 1e-21 BLAST
Blast:IG_like 165 273 2e-32 BLAST
Predicted Effect probably null
Transcript: ENSMUST00000164007
SMART Domains Protein: ENSMUSP00000130480
Gene: ENSMUSG00000036172

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
low complexity region 33 49 N/A INTRINSIC
PDB:4BFI|A 58 238 1e-42 PDB
Blast:IG 65 163 1e-21 BLAST
Blast:IG_like 165 273 2e-32 BLAST
Predicted Effect probably null
Transcript: ENSMUST00000166731
SMART Domains Protein: ENSMUSP00000128974
Gene: ENSMUSG00000036172

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
low complexity region 33 49 N/A INTRINSIC
PDB:4BFI|A 58 238 8e-43 PDB
Blast:IG 65 163 9e-22 BLAST
Blast:IG_like 165 273 2e-32 BLAST
Predicted Effect probably null
Transcript: ENSMUST00000166731
SMART Domains Protein: ENSMUSP00000128974
Gene: ENSMUSG00000036172

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
low complexity region 33 49 N/A INTRINSIC
PDB:4BFI|A 58 238 8e-43 PDB
Blast:IG 65 163 9e-22 BLAST
Blast:IG_like 165 273 2e-32 BLAST
Predicted Effect probably null
Transcript: ENSMUST00000166731
SMART Domains Protein: ENSMUSP00000128974
Gene: ENSMUSG00000036172

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
low complexity region 33 49 N/A INTRINSIC
PDB:4BFI|A 58 238 8e-43 PDB
Blast:IG 65 163 9e-22 BLAST
Blast:IG_like 165 273 2e-32 BLAST
Predicted Effect probably null
Transcript: ENSMUST00000166731
SMART Domains Protein: ENSMUSP00000128974
Gene: ENSMUSG00000036172

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
low complexity region 33 49 N/A INTRINSIC
PDB:4BFI|A 58 238 8e-43 PDB
Blast:IG 65 163 9e-22 BLAST
Blast:IG_like 165 273 2e-32 BLAST
Predicted Effect probably null
Transcript: ENSMUST00000171779
SMART Domains Protein: ENSMUSP00000132938
Gene: ENSMUSG00000036172

DomainStartEndE-ValueType
Pfam:V-set 22 164 6.7e-6 PFAM
transmembrane domain 171 193 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000171779
SMART Domains Protein: ENSMUSP00000132938
Gene: ENSMUSG00000036172

DomainStartEndE-ValueType
Pfam:V-set 22 164 6.7e-6 PFAM
transmembrane domain 171 193 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000171779
SMART Domains Protein: ENSMUSP00000132938
Gene: ENSMUSG00000036172

DomainStartEndE-ValueType
Pfam:V-set 22 164 6.7e-6 PFAM
transmembrane domain 171 193 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000171779
SMART Domains Protein: ENSMUSP00000132938
Gene: ENSMUSG00000036172

DomainStartEndE-ValueType
Pfam:V-set 22 164 6.7e-6 PFAM
transmembrane domain 171 193 N/A INTRINSIC
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 99.0%
  • 10x: 97.8%
  • 20x: 96.1%
Validation Efficiency 100% (74/74)
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810474O19Rik A T 6: 149,328,375 Q973L probably damaging Het
Adamts9 T C 6: 92,858,113 T679A possibly damaging Het
Ahr T C 12: 35,508,194 T276A probably benign Het
Akap9 A T 5: 4,064,136 Q3138H probably damaging Het
Armt1 T A 10: 4,432,689 F7I probably benign Het
B3galt2 A G 1: 143,646,140 R5G probably damaging Het
Bod1l T C 5: 41,801,233 N2750S probably benign Het
Cadps2 T A 6: 23,583,396 E365V probably damaging Het
Cst7 T A 2: 150,575,886 probably benign Het
Defb30 A T 14: 63,049,763 probably benign Het
Dido1 C T 2: 180,659,851 G2087S probably benign Het
Dio2 A G 12: 90,738,071 Y72H probably benign Het
Dnah11 C T 12: 117,987,469 E3035K probably damaging Het
Dnajb13 T C 7: 100,503,249 K287E possibly damaging Het
Dnajc11 G A 4: 151,973,628 V244I possibly damaging Het
Ect2 C T 3: 27,139,652 A226T probably damaging Het
Ercc8 G A 13: 108,174,061 probably null Het
Fam120b T A 17: 15,402,927 M389K probably benign Het
Fam151a A G 4: 106,747,931 M497V probably benign Het
Fam186b C A 15: 99,280,128 G439V probably benign Het
Fank1 A G 7: 133,876,765 Y185C probably damaging Het
Gart T C 16: 91,630,602 probably benign Het
Glb1l T C 1: 75,199,720 Y572C probably damaging Het
Gm11563 C T 11: 99,658,437 A164T unknown Het
Gnb4 C T 3: 32,591,207 V112I probably benign Het
Gsdmc3 T A 15: 63,859,693 D330V probably damaging Het
H2-DMa C T 17: 34,137,960 T144M probably damaging Het
Haus6 A T 4: 86,583,514 F707I possibly damaging Het
Hmcn1 T A 1: 150,594,016 T4971S probably benign Het
Ints6 A T 14: 62,696,759 F766L probably benign Het
Kdm5d T A Y: 927,330 M650K probably damaging Het
Kif21b T C 1: 136,159,428 F881S possibly damaging Het
Klrk1 C A 6: 129,614,635 Q176H possibly damaging Het
Ky T C 9: 102,537,621 V244A probably benign Het
Mia2 T A 12: 59,154,419 L191M possibly damaging Het
Miga2 T A 2: 30,381,744 probably benign Het
Mtss1l C T 8: 110,737,948 P322S probably damaging Het
Nalcn A G 14: 123,299,141 probably benign Het
Ncbp3 T A 11: 73,049,845 probably benign Het
Nprl3 G A 11: 32,234,876 L378F probably damaging Het
Ntrk2 A T 13: 58,846,821 M184L probably benign Het
Olfr311 T G 11: 58,841,443 C110G probably damaging Het
Olfr738 G T 14: 50,413,697 C51F probably benign Het
Osbpl9 T C 4: 109,083,128 E287G probably damaging Het
Parva T C 7: 112,576,411 F250L probably damaging Het
Pcdhb11 C T 18: 37,421,811 Q65* probably null Het
Phtf1 A G 3: 103,993,765 T377A probably damaging Het
Pkp4 G A 2: 59,322,643 V612I possibly damaging Het
Plscr2 C A 9: 92,287,654 S52R probably benign Het
Pnisr C T 4: 21,874,092 probably benign Het
Pole2 A C 12: 69,209,879 S291A probably damaging Het
Ppp2r5d A G 17: 46,684,018 F586L probably benign Het
Prrx1 G A 1: 163,257,816 R182C probably damaging Het
Ptprs A G 17: 56,429,103 I110T possibly damaging Het
Rasgrf2 G A 13: 91,919,817 probably benign Het
Riox2 T C 16: 59,491,892 V464A probably benign Het
Robo2 A G 16: 73,967,802 V646A possibly damaging Het
Ros1 T A 10: 52,118,348 I1279F probably damaging Het
Siglec1 G A 2: 131,074,268 T1254M probably benign Het
Snx7 T C 3: 117,846,675 N62D probably damaging Het
Sp100 G A 1: 85,659,867 probably null Het
Stil A T 4: 115,007,159 I86L possibly damaging Het
Tbc1d16 T A 11: 119,209,038 D170V probably benign Het
Tmem2 T A 19: 21,817,971 S743T probably benign Het
Trappc13 G A 13: 104,161,081 T105M probably damaging Het
Trhr T A 15: 44,229,500 S378T probably benign Het
Ttc7b T C 12: 100,500,073 probably null Het
Vegfc A T 8: 54,157,139 Y110F probably benign Het
Vmn1r184 C A 7: 26,267,177 P116H possibly damaging Het
Vmn2r5 A T 3: 64,503,814 C444* probably null Het
Zfp341 A G 2: 154,634,273 E460G possibly damaging Het
Zfp819 T A 7: 43,616,444 V41E probably benign Het
Other mutations in Cd200r3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02996:Cd200r3 APN 16 44954317 missense probably damaging 1.00
IGL03003:Cd200r3 APN 16 44943775 start codon destroyed probably null 0.90
IGL03003:Cd200r3 APN 16 44943776 missense probably benign 0.01
IGL03005:Cd200r3 APN 16 44953610 missense probably damaging 1.00
IGL03354:Cd200r3 APN 16 44953597 missense possibly damaging 0.64
R1451:Cd200r3 UTSW 16 44951547 missense possibly damaging 0.76
R1623:Cd200r3 UTSW 16 44951448 missense possibly damaging 0.71
R2980:Cd200r3 UTSW 16 44954189 missense probably benign 0.25
R2982:Cd200r3 UTSW 16 44954189 missense probably benign 0.25
R3758:Cd200r3 UTSW 16 44964628 splice site probably null
R4167:Cd200r3 UTSW 16 44954189 missense probably benign 0.25
R4168:Cd200r3 UTSW 16 44954189 missense probably benign 0.25
R4175:Cd200r3 UTSW 16 44954189 missense probably benign 0.25
R4534:Cd200r3 UTSW 16 44954189 missense probably benign 0.25
R4535:Cd200r3 UTSW 16 44954189 missense probably benign 0.25
R4801:Cd200r3 UTSW 16 44957825 missense possibly damaging 0.82
R4802:Cd200r3 UTSW 16 44957825 missense possibly damaging 0.82
R4937:Cd200r3 UTSW 16 44954259 missense probably benign 0.01
R5460:Cd200r3 UTSW 16 44957730 missense possibly damaging 0.66
R6109:Cd200r3 UTSW 16 44953682 missense probably benign 0.02
R8071:Cd200r3 UTSW 16 44954140 missense probably damaging 1.00
R8110:Cd200r3 UTSW 16 44951472 missense probably benign 0.41
R8906:Cd200r3 UTSW 16 44957739 missense possibly damaging 0.84
R9423:Cd200r3 UTSW 16 44951532 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CTGGAAGTTTGGGACAGGGCATTAG -3'
(R):5'- TGTTCACAATGGCCTGAAGCAGAAG -3'

Sequencing Primer
(F):5'- cagggcattaggaggcag -3'
(R):5'- AGTCCACTGTGAGTGCCAAG -3'
Posted On 2013-07-11