Incidental Mutation 'R7575:Erc1'
ID586331
Institutional Source Beutler Lab
Gene Symbol Erc1
Ensembl Gene ENSMUSG00000030172
Gene NameELKS/RAB6-interacting/CAST family member 1
SynonymsB430107L16Rik, Rab6ip2, 5033405M01Rik, RAB6IP2A, 9630025C19Rik, RAB6IP2B
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7575 (G1)
Quality Score225.009
Status Not validated
Chromosome6
Chromosomal Location119570796-119848167 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 119824760 bp
ZygosityHeterozygous
Amino Acid Change Proline to Threonine at position 99 (P99T)
Ref Sequence ENSEMBL: ENSMUSP00000032279 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032279] [ENSMUST00000079582] [ENSMUST00000183703] [ENSMUST00000183880] [ENSMUST00000183911] [ENSMUST00000184838] [ENSMUST00000184864] [ENSMUST00000185139] [ENSMUST00000185143]
Predicted Effect possibly damaging
Transcript: ENSMUST00000032279
AA Change: P99T

PolyPhen 2 Score 0.930 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000032279
Gene: ENSMUSG00000030172
AA Change: P99T

DomainStartEndE-ValueType
low complexity region 13 34 N/A INTRINSIC
low complexity region 35 51 N/A INTRINSIC
Pfam:Cast 154 466 1.8e-142 PFAM
Pfam:Cast 453 838 3.5e-163 PFAM
Pfam:Cast 833 986 8e-61 PFAM
Pfam:RBD-FIP 1072 1112 1.5e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000079582
SMART Domains Protein: ENSMUSP00000078534
Gene: ENSMUSG00000030172

DomainStartEndE-ValueType
Pfam:Cast 3 349 8.9e-149 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000183703
AA Change: P99T

PolyPhen 2 Score 0.930 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000139031
Gene: ENSMUSG00000030172
AA Change: P99T

DomainStartEndE-ValueType
low complexity region 13 34 N/A INTRINSIC
low complexity region 35 51 N/A INTRINSIC
Pfam:Cast 154 986 6.9e-291 PFAM
Pfam:RBD-FIP 1072 1112 1.5e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000183880
AA Change: P99T

PolyPhen 2 Score 0.028 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000138823
Gene: ENSMUSG00000030172
AA Change: P99T

DomainStartEndE-ValueType
low complexity region 13 34 N/A INTRINSIC
low complexity region 35 51 N/A INTRINSIC
Pfam:Cast 154 914 4.3e-296 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000183911
AA Change: P99T

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000139118
Gene: ENSMUSG00000030172
AA Change: P99T

DomainStartEndE-ValueType
low complexity region 13 34 N/A INTRINSIC
low complexity region 35 51 N/A INTRINSIC
Pfam:Cast 154 954 4.2e-293 PFAM
Pfam:RBD-FIP 1040 1080 8.5e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000184838
AA Change: P99T

PolyPhen 2 Score 0.084 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000139030
Gene: ENSMUSG00000030172
AA Change: P99T

DomainStartEndE-ValueType
low complexity region 13 34 N/A INTRINSIC
low complexity region 35 51 N/A INTRINSIC
Pfam:Cast 154 942 3.5e-291 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000184864
AA Change: P99T

PolyPhen 2 Score 0.084 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000139256
Gene: ENSMUSG00000030172
AA Change: P99T

DomainStartEndE-ValueType
low complexity region 13 34 N/A INTRINSIC
low complexity region 35 51 N/A INTRINSIC
Pfam:Cast 154 982 2e-288 PFAM
Pfam:RBD-FIP 1068 1108 8.7e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000185139
AA Change: P99T

PolyPhen 2 Score 0.023 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000139152
Gene: ENSMUSG00000030172
AA Change: P99T

DomainStartEndE-ValueType
low complexity region 13 34 N/A INTRINSIC
low complexity region 35 51 N/A INTRINSIC
Pfam:Cast 154 958 3.6e-295 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000185143
AA Change: P99T
SMART Domains Protein: ENSMUSP00000138989
Gene: ENSMUSG00000030172
AA Change: P99T

DomainStartEndE-ValueType
low complexity region 13 34 N/A INTRINSIC
low complexity region 35 51 N/A INTRINSIC
Pfam:Cast 154 224 1.7e-28 PFAM
Pfam:Cast 222 686 8e-145 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of a family of RIM-binding proteins. RIMs are active zone proteins that regulate neurotransmitter release. This gene has been found fused to the receptor-type tyrosine kinase gene RET by gene rearrangement due to the translocation t(10;12)(q11;p13) in thyroid papillary carcinoma. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2014]
PHENOTYPE: Mice homozygous for null mutations in this gene display embryonic lethality. Mice heterozygous for a gene trap null allele exhibit increased sensitivity to ionizing radiation-induced lethality, with males being more affected than females. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 91 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3425401B19Rik C T 14: 32,662,632 V459I probably benign Het
4921539E11Rik T C 4: 103,230,995 D439G probably damaging Het
Adam18 T C 8: 24,625,857 N607S possibly damaging Het
Adamtsl3 A T 7: 82,574,548 N1179I possibly damaging Het
Adarb1 A G 10: 77,303,295 F552S probably damaging Het
Ago1 T C 4: 126,453,908 E394G probably benign Het
Alb G A 5: 90,465,929 C224Y probably damaging Het
Alms1 T A 6: 85,622,159 H1322Q possibly damaging Het
Arhgef18 T G 8: 3,451,635 V643G probably damaging Het
Asah2 T C 19: 32,016,703 Q414R probably benign Het
Bbc3 G A 7: 16,312,367 R76H possibly damaging Het
BC027072 T A 17: 71,750,855 Q609L probably damaging Het
Bub1b T A 2: 118,641,158 S1000T possibly damaging Het
Bud23 A T 5: 135,061,128 Y70* probably null Het
C1d A G 11: 17,262,694 E13G probably damaging Het
Camk1 T A 6: 113,338,364 I158F probably damaging Het
Ccr2 A C 9: 124,105,806 D41A probably benign Het
Cdh18 G T 15: 23,400,597 E348* probably null Het
Col6a3 A G 1: 90,810,599 L1066P possibly damaging Het
Cyp11b1 T A 15: 74,839,313 D172V probably benign Het
Cyp2j8 A G 4: 96,470,548 I378T possibly damaging Het
Cys1 T A 12: 24,668,648 K69* probably null Het
Dip2c A G 13: 9,628,012 K1165E probably damaging Het
Drd3 A T 16: 43,817,133 I232F probably benign Het
Dusp7 T C 9: 106,373,677 C334R probably damaging Het
Eppk1 A G 15: 76,111,242 S480P not run Het
Fam170b C T 14: 32,836,198 P330L unknown Het
Fam173b C T 15: 31,606,040 A48V probably damaging Het
Fasn G T 11: 120,812,687 T1573K possibly damaging Het
Fras1 A T 5: 96,543,314 T130S probably benign Het
Fzd4 A G 7: 89,407,710 I322V possibly damaging Het
Gbp10 G A 5: 105,236,149 probably benign Het
Gdpd4 A T 7: 97,998,241 H365L probably benign Het
Gfy A G 7: 45,178,100 S191P probably benign Het
Ghr A T 15: 3,320,512 S395T probably damaging Het
Git2 C T 5: 114,766,489 R123H probably damaging Het
Htt A G 5: 34,905,643 D2873G probably damaging Het
Idua A T 5: 108,681,699 D476V probably damaging Het
Inppl1 G A 7: 101,828,482 R683W probably damaging Het
Ipp T C 4: 116,532,644 S466P probably benign Het
Iqgap2 A G 13: 95,661,623 V1058A probably damaging Het
Jmy A T 13: 93,464,595 Y434* probably null Het
Kmt2d CTGCTGCTG CTGCTGCTGATGCTGCTG 15: 98,849,611 probably benign Het
Mogs T G 6: 83,115,835 S85R probably damaging Het
Mroh2b A T 15: 4,934,605 D863V probably damaging Het
Mtmr10 A T 7: 64,297,465 I43F probably damaging Het
Mtr T C 13: 12,199,077 D903G probably benign Het
Ncor1 A G 11: 62,383,256 V186A probably benign Het
Notch3 C T 17: 32,154,819 D472N possibly damaging Het
Olfr1062 A G 2: 86,423,238 F146S probably benign Het
Olfr1294 A T 2: 111,538,252 F12L probably damaging Het
Olfr1502 T C 19: 13,862,017 S75P probably damaging Het
Olfr780 T C 10: 129,321,859 F79L probably damaging Het
Oxr1 T G 15: 41,823,362 L547V possibly damaging Het
Pappa2 A T 1: 158,814,530 C1319S probably damaging Het
Papss1 A C 3: 131,643,096 K623N probably damaging Het
Parp4 T C 14: 56,637,918 F1198S probably benign Het
Pcnt A T 10: 76,389,252 V1806D probably benign Het
Pitx2 A T 3: 129,215,726 H98L probably damaging Het
Polq C A 16: 37,091,134 D2410E probably benign Het
Prdm9 C T 17: 15,544,628 C630Y probably damaging Het
Preb A T 5: 30,958,495 D201E probably damaging Het
Rasa3 A T 8: 13,595,887 I151N possibly damaging Het
Rasgrp2 T A 19: 6,404,367 S147T probably damaging Het
Rev3l A G 10: 39,821,445 D646G possibly damaging Het
Sdc1 A G 12: 8,790,619 E128G probably damaging Het
Slamf7 A C 1: 171,639,194 C148G probably damaging Het
Slc19a2 T C 1: 164,257,122 S194P probably damaging Het
Spata31 C T 13: 64,922,912 P958L unknown Het
Sprr2b CTGAGCCTTGTCCTCCTCCAAAGTGCCCTGAGCCTTGTCCTCCCCCAGTATGCTGTGAGCCTTGTCCTCCTCCAAAGTGCCCTGAGCCTTGTCCTCCCCCAGTATGCTGTGAGCCTTGTCCTCC CTGAGCCTTGTCCTCCTCCAAAGTGCCCTGAGCCTTGTCCTCCCCCAGTATGCTGTGAGCCTTGTCCTCC 3: 92,317,519 probably benign Het
Stradb A G 1: 58,988,580 I90V probably benign Het
Tas2r134 A G 2: 51,628,154 D215G probably damaging Het
Tbc1d4 T C 14: 101,447,589 K1209E probably damaging Het
Thbs1 A G 2: 118,122,928 D942G probably damaging Het
Tmem107 C T 11: 69,072,807 P139S probably benign Het
Tmem216 A T 19: 10,551,902 M40K probably benign Het
Tpte A G 8: 22,355,482 Y516C probably damaging Het
Trim54 G A 5: 31,134,087 G184D possibly damaging Het
Try5 A T 6: 41,311,814 L157Q probably benign Het
Ubqlnl G A 7: 104,148,490 A600V probably damaging Het
Uhrf2 C A 19: 30,071,368 P258Q probably damaging Het
Ush2a A T 1: 188,822,688 E3554D possibly damaging Het
Usp40 A C 1: 87,949,960 L1158W probably damaging Het
Vmn1r121 T A 7: 21,098,273 R81* probably null Het
Vmn1r203 C A 13: 22,524,418 T123K probably benign Het
Vmn2r101 T C 17: 19,611,392 V550A probably benign Het
Wdr49 A T 3: 75,450,886 M184K probably damaging Het
Wipi2 A G 5: 142,658,232 N123S probably damaging Het
Zbtb14 T C 17: 69,387,447 F47L probably damaging Het
Zc3h7b C A 15: 81,777,885 S385* probably null Het
Zhx2 T A 15: 57,823,262 F676I probably damaging Het
Other mutations in Erc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01302:Erc1 APN 6 119722303 missense probably damaging 0.96
IGL01345:Erc1 APN 6 119761263 nonsense probably null
IGL01370:Erc1 APN 6 119824465 missense probably damaging 1.00
IGL01443:Erc1 APN 6 119824471 missense probably damaging 1.00
IGL01550:Erc1 APN 6 119783394 missense probably damaging 0.96
IGL01798:Erc1 APN 6 119620337 missense possibly damaging 0.86
IGL02032:Erc1 APN 6 119630609 missense probably damaging 1.00
IGL02239:Erc1 APN 6 119773891 missense probably damaging 0.96
IGL02341:Erc1 APN 6 119594973 missense possibly damaging 0.92
couch UTSW 6 119743429 missense possibly damaging 0.81
divan UTSW 6 119753288 missense probably benign 0.27
PIT4498001:Erc1 UTSW 6 119779491 missense possibly damaging 0.92
R0149:Erc1 UTSW 6 119824830 missense probably damaging 1.00
R0277:Erc1 UTSW 6 119620328 missense probably damaging 1.00
R0323:Erc1 UTSW 6 119620328 missense probably damaging 1.00
R1053:Erc1 UTSW 6 119796926 missense probably damaging 1.00
R1252:Erc1 UTSW 6 119743392 missense possibly damaging 0.84
R1355:Erc1 UTSW 6 119743420 nonsense probably null
R1470:Erc1 UTSW 6 119694602 missense probably damaging 1.00
R1470:Erc1 UTSW 6 119694602 missense probably damaging 1.00
R1680:Erc1 UTSW 6 119575761 missense probably damaging 1.00
R1833:Erc1 UTSW 6 119743429 missense possibly damaging 0.81
R1954:Erc1 UTSW 6 119797305 missense probably damaging 1.00
R2037:Erc1 UTSW 6 119722255 missense possibly damaging 0.94
R2365:Erc1 UTSW 6 119575695 missense probably damaging 1.00
R3751:Erc1 UTSW 6 119824960 missense probably damaging 0.99
R4473:Erc1 UTSW 6 119848456 splice site probably null
R4778:Erc1 UTSW 6 119797337 splice site probably null
R4897:Erc1 UTSW 6 119777986 critical splice donor site probably null
R5260:Erc1 UTSW 6 119761159 missense probably damaging 1.00
R5382:Erc1 UTSW 6 119761272 missense probably benign 0.02
R5405:Erc1 UTSW 6 119824944 missense probably damaging 1.00
R5801:Erc1 UTSW 6 119773822 missense probably damaging 0.99
R6341:Erc1 UTSW 6 119777998 missense possibly damaging 0.94
R6588:Erc1 UTSW 6 119575726 missense possibly damaging 0.92
R7441:Erc1 UTSW 6 119824951 missense possibly damaging 0.86
R7486:Erc1 UTSW 6 119594946 nonsense probably null
R7532:Erc1 UTSW 6 119779631 missense probably benign 0.02
R7576:Erc1 UTSW 6 119824760 missense possibly damaging 0.93
R7705:Erc1 UTSW 6 119824603 missense probably benign 0.33
R7740:Erc1 UTSW 6 119761188 missense probably benign 0.02
R7789:Erc1 UTSW 6 119773709 nonsense probably null
R7805:Erc1 UTSW 6 119713771 missense possibly damaging 0.85
R7833:Erc1 UTSW 6 119824486 nonsense probably null
R8039:Erc1 UTSW 6 119773665 nonsense probably null
R8229:Erc1 UTSW 6 119753288 missense probably benign 0.27
R8363:Erc1 UTSW 6 119753299 missense probably benign 0.00
R8794:Erc1 UTSW 6 119630655 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- GTCTGCAGATCCATGATGGTG -3'
(R):5'- GTGCTCGATCAGTAGGGAAG -3'

Sequencing Primer
(F):5'- GTTATCTCTTGCCTGACGAAGAGAG -3'
(R):5'- TCGCTTAGGTCATCGGCGAAC -3'
Posted On2019-10-24