Incidental Mutation 'R7575:Adamtsl3'
ID586336
Institutional Source Beutler Lab
Gene Symbol Adamtsl3
Ensembl Gene ENSMUSG00000070469
Gene NameADAMTS-like 3
Synonymspunctin-2, 9230119C12Rik
Accession Numbers

NCBI RefSeq: NM_001001322.2; MGI:2685556

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7575 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location82335694-82614450 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 82574548 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Isoleucine at position 1179 (N1179I)
Ref Sequence ENSEMBL: ENSMUSP00000133637 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000173287] [ENSMUST00000173828]
Predicted Effect possibly damaging
Transcript: ENSMUST00000173287
AA Change: N1179I

PolyPhen 2 Score 0.852 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000133637
Gene: ENSMUSG00000070469
AA Change: N1179I

DomainStartEndE-ValueType
signal peptide 1 38 N/A INTRINSIC
TSP1 90 136 6.43e-8 SMART
TSP1 355 414 1.59e-1 SMART
TSP1 433 492 3.72e-4 SMART
TSP1 494 547 4.28e-4 SMART
TSP1 579 638 1.85e-2 SMART
TSP1 660 717 1.75e-2 SMART
TSP1 719 773 3.45e-8 SMART
TSP1 775 833 3.67e-3 SMART
TSP1 836 894 8.99e-2 SMART
IGc2 938 1002 7.59e-4 SMART
IG 1213 1296 4.87e0 SMART
IGc2 1326 1388 1.01e-13 SMART
TSP1 1441 1498 1.95e-2 SMART
TSP1 1500 1559 6.76e-2 SMART
TSP1 1616 1666 3.84e-1 SMART
Pfam:PLAC 1674 1704 2.4e-11 PFAM
Predicted Effect
SMART Domains Protein: ENSMUSP00000133337
Gene: ENSMUSG00000070469
AA Change: N253I

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Blast:IG 22 79 1e-26 BLAST
SCOP:d1biha4 27 77 2e-5 SMART
IG 283 366 4.87e0 SMART
IGc2 396 458 1.01e-13 SMART
TSP1 511 568 1.95e-2 SMART
TSP1 570 629 6.76e-2 SMART
TSP1 686 736 3.84e-1 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype Strain: 3605825
Homozygous mutation of this gene results in thrombocytopenia, decreased survival, and increased susceptibility to developing thrombotic thrombocytopenic purpura after shiga toxin injection. On a different background, mutants are viable and fertile. (SEE BELOW)
Allele List at MGI

All alleles(10) : Targeted(7) Gene trapped(2) Spontaneous(1)

Other mutations in this stock
Total: 91 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3425401B19Rik C T 14: 32,662,632 V459I probably benign Het
4921539E11Rik T C 4: 103,230,995 D439G probably damaging Het
Adam18 T C 8: 24,625,857 N607S possibly damaging Het
Adarb1 A G 10: 77,303,295 F552S probably damaging Het
Ago1 T C 4: 126,453,908 E394G probably benign Het
Alb G A 5: 90,465,929 C224Y probably damaging Het
Alms1 T A 6: 85,622,159 H1322Q possibly damaging Het
Arhgef18 T G 8: 3,451,635 V643G probably damaging Het
Asah2 T C 19: 32,016,703 Q414R probably benign Het
Bbc3 G A 7: 16,312,367 R76H possibly damaging Het
BC027072 T A 17: 71,750,855 Q609L probably damaging Het
Bub1b T A 2: 118,641,158 S1000T possibly damaging Het
Bud23 A T 5: 135,061,128 Y70* probably null Het
C1d A G 11: 17,262,694 E13G probably damaging Het
Camk1 T A 6: 113,338,364 I158F probably damaging Het
Ccr2 A C 9: 124,105,806 D41A probably benign Het
Cdh18 G T 15: 23,400,597 E348* probably null Het
Col6a3 A G 1: 90,810,599 L1066P possibly damaging Het
Cyp11b1 T A 15: 74,839,313 D172V probably benign Het
Cyp2j8 A G 4: 96,470,548 I378T possibly damaging Het
Cys1 T A 12: 24,668,648 K69* probably null Het
Dip2c A G 13: 9,628,012 K1165E probably damaging Het
Drd3 A T 16: 43,817,133 I232F probably benign Het
Dusp7 T C 9: 106,373,677 C334R probably damaging Het
Eppk1 A G 15: 76,111,242 S480P not run Het
Erc1 G T 6: 119,824,760 P99T possibly damaging Het
Fam170b C T 14: 32,836,198 P330L unknown Het
Fam173b C T 15: 31,606,040 A48V probably damaging Het
Fasn G T 11: 120,812,687 T1573K possibly damaging Het
Fras1 A T 5: 96,543,314 T130S probably benign Het
Fzd4 A G 7: 89,407,710 I322V possibly damaging Het
Gbp10 G A 5: 105,236,149 probably benign Het
Gdpd4 A T 7: 97,998,241 H365L probably benign Het
Gfy A G 7: 45,178,100 S191P probably benign Het
Ghr A T 15: 3,320,512 S395T probably damaging Het
Git2 C T 5: 114,766,489 R123H probably damaging Het
Htt A G 5: 34,905,643 D2873G probably damaging Het
Idua A T 5: 108,681,699 D476V probably damaging Het
Inppl1 G A 7: 101,828,482 R683W probably damaging Het
Ipp T C 4: 116,532,644 S466P probably benign Het
Iqgap2 A G 13: 95,661,623 V1058A probably damaging Het
Jmy A T 13: 93,464,595 Y434* probably null Het
Kmt2d CTGCTGCTG CTGCTGCTGATGCTGCTG 15: 98,849,611 probably benign Het
Mogs T G 6: 83,115,835 S85R probably damaging Het
Mroh2b A T 15: 4,934,605 D863V probably damaging Het
Mtmr10 A T 7: 64,297,465 I43F probably damaging Het
Mtr T C 13: 12,199,077 D903G probably benign Het
Ncor1 A G 11: 62,383,256 V186A probably benign Het
Notch3 C T 17: 32,154,819 D472N possibly damaging Het
Olfr1062 A G 2: 86,423,238 F146S probably benign Het
Olfr1294 A T 2: 111,538,252 F12L probably damaging Het
Olfr1502 T C 19: 13,862,017 S75P probably damaging Het
Olfr780 T C 10: 129,321,859 F79L probably damaging Het
Oxr1 T G 15: 41,823,362 L547V possibly damaging Het
Pappa2 A T 1: 158,814,530 C1319S probably damaging Het
Papss1 A C 3: 131,643,096 K623N probably damaging Het
Parp4 T C 14: 56,637,918 F1198S probably benign Het
Pcnt A T 10: 76,389,252 V1806D probably benign Het
Pitx2 A T 3: 129,215,726 H98L probably damaging Het
Polq C A 16: 37,091,134 D2410E probably benign Het
Prdm9 C T 17: 15,544,628 C630Y probably damaging Het
Preb A T 5: 30,958,495 D201E probably damaging Het
Rasa3 A T 8: 13,595,887 I151N possibly damaging Het
Rasgrp2 T A 19: 6,404,367 S147T probably damaging Het
Rev3l A G 10: 39,821,445 D646G possibly damaging Het
Sdc1 A G 12: 8,790,619 E128G probably damaging Het
Slamf7 A C 1: 171,639,194 C148G probably damaging Het
Slc19a2 T C 1: 164,257,122 S194P probably damaging Het
Spata31 C T 13: 64,922,912 P958L unknown Het
Sprr2b CTGAGCCTTGTCCTCCTCCAAAGTGCCCTGAGCCTTGTCCTCCCCCAGTATGCTGTGAGCCTTGTCCTCCTCCAAAGTGCCCTGAGCCTTGTCCTCCCCCAGTATGCTGTGAGCCTTGTCCTCC CTGAGCCTTGTCCTCCTCCAAAGTGCCCTGAGCCTTGTCCTCCCCCAGTATGCTGTGAGCCTTGTCCTCC 3: 92,317,519 probably benign Het
Stradb A G 1: 58,988,580 I90V probably benign Het
Tas2r134 A G 2: 51,628,154 D215G probably damaging Het
Tbc1d4 T C 14: 101,447,589 K1209E probably damaging Het
Thbs1 A G 2: 118,122,928 D942G probably damaging Het
Tmem107 C T 11: 69,072,807 P139S probably benign Het
Tmem216 A T 19: 10,551,902 M40K probably benign Het
Tpte A G 8: 22,355,482 Y516C probably damaging Het
Trim54 G A 5: 31,134,087 G184D possibly damaging Het
Try5 A T 6: 41,311,814 L157Q probably benign Het
Ubqlnl G A 7: 104,148,490 A600V probably damaging Het
Uhrf2 C A 19: 30,071,368 P258Q probably damaging Het
Ush2a A T 1: 188,822,688 E3554D possibly damaging Het
Usp40 A C 1: 87,949,960 L1158W probably damaging Het
Vmn1r121 T A 7: 21,098,273 R81* probably null Het
Vmn1r203 C A 13: 22,524,418 T123K probably benign Het
Vmn2r101 T C 17: 19,611,392 V550A probably benign Het
Wdr49 A T 3: 75,450,886 M184K probably damaging Het
Wipi2 A G 5: 142,658,232 N123S probably damaging Het
Zbtb14 T C 17: 69,387,447 F47L probably damaging Het
Zc3h7b C A 15: 81,777,885 S385* probably null Het
Zhx2 T A 15: 57,823,262 F676I probably damaging Het
Other mutations in Adamtsl3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01549:Adamtsl3 APN 7 82612448 missense probably damaging 1.00
IGL01936:Adamtsl3 APN 7 82595371 missense possibly damaging 0.93
IGL02819:Adamtsl3 APN 7 82574121 missense probably damaging 0.99
P0012:Adamtsl3 UTSW 7 82574257 missense probably benign 0.27
R0096:Adamtsl3 UTSW 7 82465699 intron probably benign
R0096:Adamtsl3 UTSW 7 82465699 intron probably benign
R0180:Adamtsl3 UTSW 7 82575990 missense probably benign 0.00
R0270:Adamtsl3 UTSW 7 82556824 missense probably damaging 1.00
R0295:Adamtsl3 UTSW 7 82548005 critical splice donor site probably null
R0329:Adamtsl3 UTSW 7 82521990 missense probably damaging 1.00
R0330:Adamtsl3 UTSW 7 82521990 missense probably damaging 1.00
R0548:Adamtsl3 UTSW 7 82528983 critical splice donor site probably null
R0611:Adamtsl3 UTSW 7 82528912 missense probably damaging 1.00
R0671:Adamtsl3 UTSW 7 82523182 missense probably damaging 1.00
R0711:Adamtsl3 UTSW 7 82465699 intron probably benign
R0845:Adamtsl3 UTSW 7 82575996 missense probably damaging 1.00
R1119:Adamtsl3 UTSW 7 82540317 missense probably damaging 0.96
R1458:Adamtsl3 UTSW 7 82523320 missense probably damaging 1.00
R1644:Adamtsl3 UTSW 7 82450090 missense possibly damaging 0.87
R1691:Adamtsl3 UTSW 7 82499606 missense probably damaging 1.00
R1838:Adamtsl3 UTSW 7 82493373 missense probably damaging 1.00
R2131:Adamtsl3 UTSW 7 82578594 missense probably damaging 1.00
R2245:Adamtsl3 UTSW 7 82450100 missense probably damaging 1.00
R2274:Adamtsl3 UTSW 7 82606558 missense probably benign 0.37
R2275:Adamtsl3 UTSW 7 82606558 missense probably benign 0.37
R2448:Adamtsl3 UTSW 7 82499748 missense probably damaging 1.00
R3725:Adamtsl3 UTSW 7 82612404 missense possibly damaging 0.80
R3757:Adamtsl3 UTSW 7 82337207 missense probably benign 0.01
R3821:Adamtsl3 UTSW 7 82606479 splice site probably benign
R4618:Adamtsl3 UTSW 7 82606520 missense probably benign 0.41
R4842:Adamtsl3 UTSW 7 82528861 missense probably damaging 1.00
R4887:Adamtsl3 UTSW 7 82574614 missense possibly damaging 0.87
R4888:Adamtsl3 UTSW 7 82574614 missense possibly damaging 0.87
R4925:Adamtsl3 UTSW 7 82602299 critical splice donor site probably null
R4960:Adamtsl3 UTSW 7 82566977 missense probably damaging 0.99
R5026:Adamtsl3 UTSW 7 82576054 missense probably benign 0.07
R5152:Adamtsl3 UTSW 7 82574544 missense probably benign 0.11
R5198:Adamtsl3 UTSW 7 82611798 missense possibly damaging 0.63
R5244:Adamtsl3 UTSW 7 82598069 missense probably benign 0.02
R5281:Adamtsl3 UTSW 7 82528934 missense probably damaging 1.00
R5323:Adamtsl3 UTSW 7 82557061 missense probably damaging 1.00
R5523:Adamtsl3 UTSW 7 82574442 missense possibly damaging 0.86
R5602:Adamtsl3 UTSW 7 82557239 missense possibly damaging 0.89
R5638:Adamtsl3 UTSW 7 82611750 missense probably damaging 0.99
R5682:Adamtsl3 UTSW 7 82606550 missense probably damaging 0.99
R5782:Adamtsl3 UTSW 7 82540286 intron probably null
R5946:Adamtsl3 UTSW 7 82576057 missense probably damaging 0.98
R6091:Adamtsl3 UTSW 7 82465621 missense probably damaging 1.00
R6258:Adamtsl3 UTSW 7 82528983 critical splice donor site probably null
R6500:Adamtsl3 UTSW 7 82578610 missense probably benign 0.00
R6765:Adamtsl3 UTSW 7 82567024 missense possibly damaging 0.60
R6785:Adamtsl3 UTSW 7 82522004 missense probably damaging 0.99
R6982:Adamtsl3 UTSW 7 82515063 missense probably damaging 1.00
R7109:Adamtsl3 UTSW 7 82611861 missense
R7341:Adamtsl3 UTSW 7 82556874 missense probably damaging 1.00
R7402:Adamtsl3 UTSW 7 82578617 missense probably damaging 0.96
R7506:Adamtsl3 UTSW 7 82514978 missense probably damaging 1.00
R7549:Adamtsl3 UTSW 7 82573909 missense probably damaging 1.00
R7592:Adamtsl3 UTSW 7 82337251 missense probably benign 0.00
R7654:Adamtsl3 UTSW 7 82574494 missense probably benign
R7721:Adamtsl3 UTSW 7 82606520 missense possibly damaging 0.62
R7784:Adamtsl3 UTSW 7 82573989 missense probably damaging 1.00
RF005:Adamtsl3 UTSW 7 82612395 missense
X0003:Adamtsl3 UTSW 7 82611759 nonsense probably null
X0063:Adamtsl3 UTSW 7 82574157 missense probably benign 0.25
Z1088:Adamtsl3 UTSW 7 82499714 missense probably damaging 1.00
Z1088:Adamtsl3 UTSW 7 82540325 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CATGGACACAGCCCAATTTG -3'
(R):5'- CTCCTTGCTGGGAGTAATGAGG -3'

Sequencing Primer
(F):5'- CATGGACACAGCCCAATTTGATGAG -3'
(R):5'- GGCTGCAAAGTATATTGATGATCTCC -3'
Posted On2019-10-24