Mutagenetix > Incidental Mutations

Incidental Mutation 'R0620:Robo2'

58634

Institutional Source

Beutler Lab

Gene Symbol

Robo2

Ensembl Gene

ENSMUSG00000052516

Gene Name

roundabout guidance receptor 2

Synonyms

9430089E08Rik, 2600013A04Rik, D230004I22Rik

MMRRC Submission

038809-MU

Accession Numbers

Ncbi RefSeq: NM_175549.4; MGI:1890110

Is this an essential gene?

Probably essential (E-score: 0.922) question?

Stock #

R0620 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

73891839-74411825 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 73967802 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 646 (V646A)

Ref Sequence

ENSEMBL: ENSMUSP00000112776 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000117200] [ENSMUST00000117785] [ENSMUST00000226478] [ENSMUST00000227347]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000116586
AA Change: V650A

PolyPhen 2 Score 0.445 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000112285
Gene: ENSMUSG00000052516
AA Change: V650A

Domain	Start	End	E-Value	Type
signal peptide	1	21	N/A	INTRINSIC
IGc2	43	117	3.56e-9	SMART
IGc2	145	210	3.33e-9	SMART
IGc2	237	300	6.59e-13	SMART
IGc2	330	402	1.3e-11	SMART
IGc2	434	499	3.73e-12	SMART
FN3	526	608	1.42e-15	SMART
FN3	640	725	3.54e-2	SMART
FN3	740	827	6.15e-11	SMART
transmembrane domain	864	886	N/A	INTRINSIC
low complexity region	1044	1069	N/A	INTRINSIC
low complexity region	1076	1087	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000117200
AA Change: V646A

PolyPhen 2 Score 0.674 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000113795
Gene: ENSMUSG00000052516
AA Change: V646A

Domain	Start	End	E-Value	Type
signal peptide	1	21	N/A	INTRINSIC
IGc2	43	117	3.56e-9	SMART
IGc2	145	210	3.33e-9	SMART
IGc2	237	300	6.59e-13	SMART
IGc2	326	398	1.3e-11	SMART
IGc2	430	495	3.73e-12	SMART
FN3	522	604	1.42e-15	SMART
FN3	636	721	3.54e-2	SMART
FN3	736	823	6.15e-11	SMART
transmembrane domain	860	882	N/A	INTRINSIC
low complexity region	1040	1065	N/A	INTRINSIC
low complexity region	1072	1083	N/A	INTRINSIC
low complexity region	1191	1199	N/A	INTRINSIC
low complexity region	1210	1234	N/A	INTRINSIC
low complexity region	1318	1342	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000117785
AA Change: V646A

PolyPhen 2 Score 0.917 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000112776
Gene: ENSMUSG00000052516
AA Change: V646A

Domain	Start	End	E-Value	Type
signal peptide	1	21	N/A	INTRINSIC
IGc2	43	117	3.56e-9	SMART
IGc2	145	210	3.33e-9	SMART
IGc2	237	300	6.59e-13	SMART
IGc2	326	398	1.3e-11	SMART
IGc2	430	495	3.73e-12	SMART
FN3	522	604	1.42e-15	SMART
FN3	636	721	3.54e-2	SMART
FN3	736	823	6.15e-11	SMART
transmembrane domain	860	882	N/A	INTRINSIC
low complexity region	1072	1107	N/A	INTRINSIC
low complexity region	1114	1125	N/A	INTRINSIC
low complexity region	1233	1241	N/A	INTRINSIC
low complexity region	1252	1276	N/A	INTRINSIC
low complexity region	1351	1362	N/A	INTRINSIC
low complexity region	1451	1475	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000226478
AA Change: V650A

PolyPhen 2 Score 0.861 (Sensitivity: 0.83; Specificity: 0.93)

Predicted Effect

possibly damaging
Transcript: ENSMUST00000227347
AA Change: V650A

PolyPhen 2 Score 0.800 (Sensitivity: 0.84; Specificity: 0.93)

Meta Mutation Damage Score

0.0795

Coding Region Coverage

1x: 99.4%
3x: 99.0%
10x: 97.8%
20x: 96.1%

Validation Efficiency

100% (74/74)

MGI Phenotype

Strain: 3759448; 3043127
Lethality: D1
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the ROBO family, part of the immunoglobulin superfamily of proteins that are highly conserved from fly to human. The encoded protein is a transmembrane receptor for the slit homolog 2 protein and functions in axon guidance and cell migration. Mutations in this gene are associated with vesicoureteral reflux, characterized by the backward flow of urine from the bladder into the ureters or the kidney. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2014]
PHENOTYPE: Homozygous mutants display postnatal lethality, abnormal ureteric bud development, multiple fused kidneys, multiple ureters, and abnormal commissural axon growth. [provided by MGI curators]

Allele List at MGI

All alleles(6) : Targeted(3) Gene trapped(3)

Other mutations in this stock

Total: 72 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2810474O19Rik	A	T	6: 149,328,375	Q973L	probably damaging	Het
Adamts9	T	C	6: 92,858,113	T679A	possibly damaging	Het
Ahr	T	C	12: 35,508,194	T276A	probably benign	Het
Akap9	A	T	5: 4,064,136	Q3138H	probably damaging	Het
Armt1	T	A	10: 4,432,689	F7I	probably benign	Het
B3galt2	A	G	1: 143,646,140	R5G	probably damaging	Het
Bod1l	T	C	5: 41,801,233	N2750S	probably benign	Het
Cadps2	T	A	6: 23,583,396	E365V	probably damaging	Het
Cd200r3	T	A	16: 44,957,717		probably null	Het
Cst7	T	A	2: 150,575,886		probably benign	Het
Defb30	A	T	14: 63,049,763		probably benign	Het
Dido1	C	T	2: 180,659,851	G2087S	probably benign	Het
Dio2	A	G	12: 90,738,071	Y72H	probably benign	Het
Dnah11	C	T	12: 117,987,469	E3035K	probably damaging	Het
Dnajb13	T	C	7: 100,503,249	K287E	possibly damaging	Het
Dnajc11	G	A	4: 151,973,628	V244I	possibly damaging	Het
Ect2	C	T	3: 27,139,652	A226T	probably damaging	Het
Ercc8	G	A	13: 108,174,061		probably null	Het
Fam120b	T	A	17: 15,402,927	M389K	probably benign	Het
Fam151a	A	G	4: 106,747,931	M497V	probably benign	Het
Fam186b	C	A	15: 99,280,128	G439V	probably benign	Het
Fank1	A	G	7: 133,876,765	Y185C	probably damaging	Het
Gart	T	C	16: 91,630,602		probably benign	Het
Glb1l	T	C	1: 75,199,720	Y572C	probably damaging	Het
Gm11563	C	T	11: 99,658,437	A164T	unknown	Het
Gnb4	C	T	3: 32,591,207	V112I	probably benign	Het
Gsdmc3	T	A	15: 63,859,693	D330V	probably damaging	Het
H2-DMa	C	T	17: 34,137,960	T144M	probably damaging	Het
Haus6	A	T	4: 86,583,514	F707I	possibly damaging	Het
Hmcn1	T	A	1: 150,594,016	T4971S	probably benign	Het
Ints6	A	T	14: 62,696,759	F766L	probably benign	Het
Kdm5d	T	A	Y: 927,330	M650K	probably damaging	Het
Kif21b	T	C	1: 136,159,428	F881S	possibly damaging	Het
Klrk1	C	A	6: 129,614,635	Q176H	possibly damaging	Het
Ky	T	C	9: 102,537,621	V244A	probably benign	Het
Mia2	T	A	12: 59,154,419	L191M	possibly damaging	Het
Miga2	T	A	2: 30,381,744		probably benign	Het
Mtss1l	C	T	8: 110,737,948	P322S	probably damaging	Het
Nalcn	A	G	14: 123,299,141		probably benign	Het
Ncbp3	T	A	11: 73,049,845		probably benign	Het
Nprl3	G	A	11: 32,234,876	L378F	probably damaging	Het
Ntrk2	A	T	13: 58,846,821	M184L	probably benign	Het
Olfr311	T	G	11: 58,841,443	C110G	probably damaging	Het
Olfr738	G	T	14: 50,413,697	C51F	probably benign	Het
Osbpl9	T	C	4: 109,083,128	E287G	probably damaging	Het
Parva	T	C	7: 112,576,411	F250L	probably damaging	Het
Pcdhb11	C	T	18: 37,421,811	Q65*	probably null	Het
Phtf1	A	G	3: 103,993,765	T377A	probably damaging	Het
Pkp4	G	A	2: 59,322,643	V612I	possibly damaging	Het
Plscr2	C	A	9: 92,287,654	S52R	probably benign	Het
Pnisr	C	T	4: 21,874,092		probably benign	Het
Pole2	A	C	12: 69,209,879	S291A	probably damaging	Het
Ppp2r5d	A	G	17: 46,684,018	F586L	probably benign	Het
Prrx1	G	A	1: 163,257,816	R182C	probably damaging	Het
Ptprs	A	G	17: 56,429,103	I110T	possibly damaging	Het
Rasgrf2	G	A	13: 91,919,817		probably benign	Het
Riox2	T	C	16: 59,491,892	V464A	probably benign	Het
Ros1	T	A	10: 52,118,348	I1279F	probably damaging	Het
Siglec1	G	A	2: 131,074,268	T1254M	probably benign	Het
Snx7	T	C	3: 117,846,675	N62D	probably damaging	Het
Sp100	G	A	1: 85,659,867		probably null	Het
Stil	A	T	4: 115,007,159	I86L	possibly damaging	Het
Tbc1d16	T	A	11: 119,209,038	D170V	probably benign	Het
Tmem2	T	A	19: 21,817,971	S743T	probably benign	Het
Trappc13	G	A	13: 104,161,081	T105M	probably damaging	Het
Trhr	T	A	15: 44,229,500	S378T	probably benign	Het
Ttc7b	T	C	12: 100,500,073		probably null	Het
Vegfc	A	T	8: 54,157,139	Y110F	probably benign	Het
Vmn1r184	C	A	7: 26,267,177	P116H	possibly damaging	Het
Vmn2r5	A	T	3: 64,503,814	C444*	probably null	Het
Zfp341	A	G	2: 154,634,273	E460G	possibly damaging	Het
Zfp819	T	A	7: 43,616,444	V41E	probably benign	Het

Other mutations in Robo2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00666:Robo2	APN	16	73961700	missense	probably benign
IGL00849:Robo2	APN	16	73973777	missense	possibly damaging	0.80
IGL00908:Robo2	APN	16	73985691	missense	probably damaging	0.98
IGL00944:Robo2	APN	16	73933697	missense	possibly damaging	0.92
IGL00955:Robo2	APN	16	74015972	missense	probably damaging	1.00
IGL00970:Robo2	APN	16	73897046	missense	probably benign	0.00
IGL01020:Robo2	APN	16	73928151	missense	probably benign	0.06
IGL01347:Robo2	APN	16	74352856	missense	probably damaging	1.00
IGL02280:Robo2	APN	16	74046816	missense	probably damaging	1.00
IGL02424:Robo2	APN	16	73973301	missense	possibly damaging	0.89
IGL03376:Robo2	APN	16	73956492	missense	probably damaging	1.00
LCD18:Robo2	UTSW	16	74055954	intron	probably benign
P0018:Robo2	UTSW	16	74046806	missense	possibly damaging	0.82
R0314:Robo2	UTSW	16	73956637	missense	probably damaging	1.00
R0324:Robo2	UTSW	16	73967851	missense	probably damaging	1.00
R0539:Robo2	UTSW	16	73985574	splice site	probably benign
R0630:Robo2	UTSW	16	73916205	missense	probably benign	0.05
R0701:Robo2	UTSW	16	74046874	missense	probably damaging	1.00
R1155:Robo2	UTSW	16	74035108	missense	probably damaging	1.00
R1168:Robo2	UTSW	16	73948296	missense	probably damaging	1.00
R1195:Robo2	UTSW	16	73916128	splice site	probably null
R1195:Robo2	UTSW	16	73916128	splice site	probably null
R1195:Robo2	UTSW	16	73916128	splice site	probably null
R1317:Robo2	UTSW	16	74035024	missense	probably damaging	1.00
R1422:Robo2	UTSW	16	73978448	missense	probably damaging	0.99
R1452:Robo2	UTSW	16	73961910	missense	probably damaging	1.00
R1649:Robo2	UTSW	16	73899001	missense	probably benign	0.36
R1709:Robo2	UTSW	16	73956523	missense	possibly damaging	0.83
R1751:Robo2	UTSW	16	74035024	missense	probably damaging	1.00
R1761:Robo2	UTSW	16	74035024	missense	probably damaging	1.00
R1885:Robo2	UTSW	16	73916145	missense	probably benign	0.00
R1911:Robo2	UTSW	16	73958325	missense	probably damaging	1.00
R1919:Robo2	UTSW	16	73899154	missense	probably benign
R2005:Robo2	UTSW	16	73933115	missense	possibly damaging	0.82
R2851:Robo2	UTSW	16	73961888	missense	probably damaging	1.00
R3732:Robo2	UTSW	16	73920747	missense	possibly damaging	0.64
R3732:Robo2	UTSW	16	73920747	missense	possibly damaging	0.64
R3733:Robo2	UTSW	16	73920747	missense	possibly damaging	0.64
R3734:Robo2	UTSW	16	73920747	missense	possibly damaging	0.64
R3913:Robo2	UTSW	16	74035005	missense	probably damaging	1.00
R3956:Robo2	UTSW	16	73961867	missense	probably damaging	1.00
R4394:Robo2	UTSW	16	73948379	missense	probably benign	0.13
R4426:Robo2	UTSW	16	73948266	missense	probably damaging	1.00
R4437:Robo2	UTSW	16	73973244	missense	possibly damaging	0.88
R4454:Robo2	UTSW	16	74352519	intron	probably benign
R4478:Robo2	UTSW	16	74015873	missense	probably damaging	1.00
R4586:Robo2	UTSW	16	73961873	missense	probably damaging	0.96
R4621:Robo2	UTSW	16	73985933	missense	probably benign	0.00
R4673:Robo2	UTSW	16	73904378	splice site	probably null
R4798:Robo2	UTSW	16	74352745	missense	probably damaging	1.00
R4812:Robo2	UTSW	16	73916288	missense	probably benign	0.00
R4855:Robo2	UTSW	16	73971191	missense	probably damaging	1.00
R4910:Robo2	UTSW	16	73933778	missense	probably damaging	0.99
R4916:Robo2	UTSW	16	73898915	missense	possibly damaging	0.53
R4948:Robo2	UTSW	16	74352838	missense	possibly damaging	0.88
R5325:Robo2	UTSW	16	73973785	missense	possibly damaging	0.72
R5326:Robo2	UTSW	16	73898965	missense	probably benign	0.20
R5447:Robo2	UTSW	16	73973766	nonsense	probably null
R5542:Robo2	UTSW	16	73898965	missense	probably benign	0.20
R5545:Robo2	UTSW	16	73961747	missense	probably damaging	1.00
R5646:Robo2	UTSW	16	73961819	missense	probably damaging	0.99
R5734:Robo2	UTSW	16	74352784	missense	probably damaging	1.00
R5892:Robo2	UTSW	16	73895780	utr 3 prime	probably benign
R5960:Robo2	UTSW	16	73933715	missense	probably damaging	1.00
R6126:Robo2	UTSW	16	73920682	missense	probably benign	0.00
R6130:Robo2	UTSW	16	73920682	missense	probably benign	0.00
R6153:Robo2	UTSW	16	73920729	missense	probably damaging	1.00
R6240:Robo2	UTSW	16	73982139	missense	probably damaging	1.00
R6247:Robo2	UTSW	16	73967784	missense	probably damaging	1.00
R6304:Robo2	UTSW	16	73958308	missense	probably damaging	1.00
R6337:Robo2	UTSW	16	73928151	missense	probably benign	0.06
R6431:Robo2	UTSW	16	74046809	nonsense	probably null
R6440:Robo2	UTSW	16	73916122	missense	probably benign	0.31
R6596:Robo2	UTSW	16	73971108	missense	probably damaging	1.00
R6919:Robo2	UTSW	16	73961867	missense	probably damaging	1.00
R6927:Robo2	UTSW	16	73982058	missense	probably damaging	1.00
R7029:Robo2	UTSW	16	73948337	missense	probably damaging	1.00
R7078:Robo2	UTSW	16	74352616	missense	probably damaging	1.00
R7092:Robo2	UTSW	16	73956643	missense	probably damaging	0.99
R7136:Robo2	UTSW	16	73956550	missense	probably damaging	0.99
R7192:Robo2	UTSW	16	73920750	missense	probably benign	0.19
R7569:Robo2	UTSW	16	74035115	missense	possibly damaging	0.82
R7686:Robo2	UTSW	16	73958405	missense	probably damaging	1.00
R7720:Robo2	UTSW	16	73897015	missense	probably benign	0.00
R7772:Robo2	UTSW	16	73961889	missense	probably benign	0.24
R7822:Robo2	UTSW	16	73973171	missense	probably damaging	1.00
R7849:Robo2	UTSW	16	73973244	missense	possibly damaging	0.88
R7881:Robo2	UTSW	16	73920697	missense	probably benign	0.00
R7897:Robo2	UTSW	16	73898950	missense	probably benign
R8135:Robo2	UTSW	16	73933160	missense	probably benign	0.04
R8297:Robo2	UTSW	16	74015926	nonsense	probably null
R8307:Robo2	UTSW	16	73956610	missense	probably damaging	1.00
R8379:Robo2	UTSW	16	73933700	missense	probably damaging	0.99
R8393:Robo2	UTSW	16	73978494	missense	probably damaging	1.00
R8474:Robo2	UTSW	16	73948262	missense	probably damaging	1.00
R8500:Robo2	UTSW	16	73948340	missense	probably damaging	1.00
R8721:Robo2	UTSW	16	73906910	missense
R8734:Robo2	UTSW	16	73967763	splice site	probably benign
R8735:Robo2	UTSW	16	73958359	missense	probably damaging	1.00
R8840:Robo2	UTSW	16	73985682	missense	probably damaging	1.00
R8937:Robo2	UTSW	16	73973261	missense	probably damaging	1.00
R8937:Robo2	UTSW	16	73973262	missense	probably damaging	1.00
R8968:Robo2	UTSW	16	73971053	critical splice donor site	probably null
R9134:Robo2	UTSW	16	73906850	missense
X0063:Robo2	UTSW	16	74045828	missense	probably damaging	1.00
Z1176:Robo2	UTSW	16	73933591	missense	probably benign	0.35
Z1177:Robo2	UTSW	16	73940299	critical splice acceptor site	probably null

Predicted Primers

PCR Primer
(F):5'- CCTGTAACTTTCGCATGTTGACTGC -3'
(R):5'- CGGAAAATACTTCAGGGCCTCATCATC -3'

Sequencing Primer
(F):5'- GCCAGGAAGGTTAGACTTCTATTTC -3'
(R):5'- AGGGTACAGTCTCTACTCTAACTCAG -3'

Posted On

2013-07-11