Incidental Mutation 'R0620:Gart'
ID58635
Institutional Source Beutler Lab
Gene Symbol Gart
Ensembl Gene ENSMUSG00000022962
Gene Namephosphoribosylglycinamide formyltransferase
SynonymsGaps, Prgs
MMRRC Submission 038809-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0620 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location91621186-91646952 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to C at 91630602 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000156002 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023684] [ENSMUST00000120450] [ENSMUST00000156713] [ENSMUST00000231380] [ENSMUST00000232289]
Predicted Effect probably benign
Transcript: ENSMUST00000023684
SMART Domains Protein: ENSMUSP00000023684
Gene: ENSMUSG00000022962

DomainStartEndE-ValueType
Pfam:GARS_N 3 104 6.4e-37 PFAM
GARS_A 105 298 4.42e-132 SMART
GARS_C 333 426 1.33e-44 SMART
Pfam:AIRS 473 593 1.2e-17 PFAM
Pfam:AIRS_C 606 777 9e-40 PFAM
Pfam:Formyl_trans_N 808 988 3.4e-68 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000120450
SMART Domains Protein: ENSMUSP00000114034
Gene: ENSMUSG00000022962

DomainStartEndE-ValueType
Pfam:GARS_N 3 104 1.8e-40 PFAM
GARS_A 105 298 4.42e-132 SMART
GARS_C 333 426 1.33e-44 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000156713
SMART Domains Protein: ENSMUSP00000119272
Gene: ENSMUSG00000022962

DomainStartEndE-ValueType
Pfam:GARS_N 3 104 1.4e-40 PFAM
GARS_A 105 298 4.42e-132 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000231380
Predicted Effect probably benign
Transcript: ENSMUST00000232289
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 99.0%
  • 10x: 97.8%
  • 20x: 96.1%
Validation Efficiency 100% (74/74)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a trifunctional polypeptide. It has phosphoribosylglycinamide formyltransferase, phosphoribosylglycinamide synthetase, phosphoribosylaminoimidazole synthetase activity which is required for de novo purine biosynthesis. This enzyme is highly conserved in vertebrates. Alternative splicing of this gene results in two transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810474O19Rik A T 6: 149,328,375 Q973L probably damaging Het
Adamts9 T C 6: 92,858,113 T679A possibly damaging Het
Ahr T C 12: 35,508,194 T276A probably benign Het
Akap9 A T 5: 4,064,136 Q3138H probably damaging Het
Armt1 T A 10: 4,432,689 F7I probably benign Het
B3galt2 A G 1: 143,646,140 R5G probably damaging Het
Bod1l T C 5: 41,801,233 N2750S probably benign Het
Cadps2 T A 6: 23,583,396 E365V probably damaging Het
Cd200r3 T A 16: 44,957,717 probably null Het
Cst7 T A 2: 150,575,886 probably benign Het
Defb30 A T 14: 63,049,763 probably benign Het
Dido1 C T 2: 180,659,851 G2087S probably benign Het
Dio2 A G 12: 90,738,071 Y72H probably benign Het
Dnah11 C T 12: 117,987,469 E3035K probably damaging Het
Dnajb13 T C 7: 100,503,249 K287E possibly damaging Het
Dnajc11 G A 4: 151,973,628 V244I possibly damaging Het
Ect2 C T 3: 27,139,652 A226T probably damaging Het
Ercc8 G A 13: 108,174,061 probably null Het
Fam120b T A 17: 15,402,927 M389K probably benign Het
Fam151a A G 4: 106,747,931 M497V probably benign Het
Fam186b C A 15: 99,280,128 G439V probably benign Het
Fank1 A G 7: 133,876,765 Y185C probably damaging Het
Glb1l T C 1: 75,199,720 Y572C probably damaging Het
Gm11563 C T 11: 99,658,437 A164T unknown Het
Gnb4 C T 3: 32,591,207 V112I probably benign Het
Gsdmc3 T A 15: 63,859,693 D330V probably damaging Het
H2-DMa C T 17: 34,137,960 T144M probably damaging Het
Haus6 A T 4: 86,583,514 F707I possibly damaging Het
Hmcn1 T A 1: 150,594,016 T4971S probably benign Het
Ints6 A T 14: 62,696,759 F766L probably benign Het
Kdm5d T A Y: 927,330 M650K probably damaging Het
Kif21b T C 1: 136,159,428 F881S possibly damaging Het
Klrk1 C A 6: 129,614,635 Q176H possibly damaging Het
Ky T C 9: 102,537,621 V244A probably benign Het
Mia2 T A 12: 59,154,419 L191M possibly damaging Het
Miga2 T A 2: 30,381,744 probably benign Het
Mtss1l C T 8: 110,737,948 P322S probably damaging Het
Nalcn A G 14: 123,299,141 probably benign Het
Ncbp3 T A 11: 73,049,845 probably benign Het
Nprl3 G A 11: 32,234,876 L378F probably damaging Het
Ntrk2 A T 13: 58,846,821 M184L probably benign Het
Olfr311 T G 11: 58,841,443 C110G probably damaging Het
Olfr738 G T 14: 50,413,697 C51F probably benign Het
Osbpl9 T C 4: 109,083,128 E287G probably damaging Het
Parva T C 7: 112,576,411 F250L probably damaging Het
Pcdhb11 C T 18: 37,421,811 Q65* probably null Het
Phtf1 A G 3: 103,993,765 T377A probably damaging Het
Pkp4 G A 2: 59,322,643 V612I possibly damaging Het
Plscr2 C A 9: 92,287,654 S52R probably benign Het
Pnisr C T 4: 21,874,092 probably benign Het
Pole2 A C 12: 69,209,879 S291A probably damaging Het
Ppp2r5d A G 17: 46,684,018 F586L probably benign Het
Prrx1 G A 1: 163,257,816 R182C probably damaging Het
Ptprs A G 17: 56,429,103 I110T possibly damaging Het
Rasgrf2 G A 13: 91,919,817 probably benign Het
Riox2 T C 16: 59,491,892 V464A probably benign Het
Robo2 A G 16: 73,967,802 V646A possibly damaging Het
Ros1 T A 10: 52,118,348 I1279F probably damaging Het
Siglec1 G A 2: 131,074,268 T1254M probably benign Het
Snx7 T C 3: 117,846,675 N62D probably damaging Het
Sp100 G A 1: 85,659,867 probably null Het
Stil A T 4: 115,007,159 I86L possibly damaging Het
Tbc1d16 T A 11: 119,209,038 D170V probably benign Het
Tmem2 T A 19: 21,817,971 S743T probably benign Het
Trappc13 G A 13: 104,161,081 T105M probably damaging Het
Trhr T A 15: 44,229,500 S378T probably benign Het
Ttc7b T C 12: 100,500,073 probably null Het
Vegfc A T 8: 54,157,139 Y110F probably benign Het
Vmn1r184 C A 7: 26,267,177 P116H possibly damaging Het
Vmn2r5 A T 3: 64,503,814 C444* probably null Het
Zfp341 A G 2: 154,634,273 E460G possibly damaging Het
Zfp819 T A 7: 43,616,444 V41E probably benign Het
Other mutations in Gart
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00597:Gart APN 16 91638789 missense possibly damaging 0.58
IGL00837:Gart APN 16 91638720 unclassified probably benign
IGL01010:Gart APN 16 91643092 nonsense probably null
IGL01064:Gart APN 16 91623007 missense probably damaging 1.00
IGL01451:Gart APN 16 91625512 missense probably benign
IGL02084:Gart APN 16 91621600 missense probably benign
IGL02301:Gart APN 16 91621837 splice site probably benign
IGL02814:Gart APN 16 91623457 missense possibly damaging 0.58
sylvester UTSW 16 91630602 splice site probably benign
PIT4453001:Gart UTSW 16 91636538 missense probably damaging 1.00
R0137:Gart UTSW 16 91625394 missense probably benign
R0197:Gart UTSW 16 91623403 missense possibly damaging 0.95
R0321:Gart UTSW 16 91623037 unclassified probably benign
R0322:Gart UTSW 16 91623037 unclassified probably benign
R0398:Gart UTSW 16 91639449 missense probably damaging 1.00
R0410:Gart UTSW 16 91641327 missense probably damaging 1.00
R0496:Gart UTSW 16 91623037 unclassified probably benign
R0628:Gart UTSW 16 91633902 missense probably benign 0.01
R0883:Gart UTSW 16 91623403 missense possibly damaging 0.95
R1346:Gart UTSW 16 91628182 splice site probably null
R1490:Gart UTSW 16 91624344 missense probably damaging 1.00
R1686:Gart UTSW 16 91625349 missense probably damaging 1.00
R1751:Gart UTSW 16 91642949 splice site probably benign
R1917:Gart UTSW 16 91628149 missense probably damaging 1.00
R2144:Gart UTSW 16 91630081 missense probably damaging 1.00
R2421:Gart UTSW 16 91643040 unclassified probably null
R4305:Gart UTSW 16 91633992 missense possibly damaging 0.48
R4377:Gart UTSW 16 91634094 missense probably benign 0.31
R4599:Gart UTSW 16 91622945 nonsense probably null
R4619:Gart UTSW 16 91625433 missense probably damaging 1.00
R4620:Gart UTSW 16 91625433 missense probably damaging 1.00
R5112:Gart UTSW 16 91634045 missense probably benign 0.02
R5902:Gart UTSW 16 91628527 missense probably damaging 1.00
R5975:Gart UTSW 16 91624336 missense probably damaging 1.00
R6736:Gart UTSW 16 91636107 missense probably benign 0.21
R7041:Gart UTSW 16 91643143 start gained probably benign
R7150:Gart UTSW 16 91628463 missense possibly damaging 0.69
R7320:Gart UTSW 16 91621681 missense probably benign 0.00
R7709:Gart UTSW 16 91622965 missense possibly damaging 0.92
R7748:Gart UTSW 16 91630652 missense possibly damaging 0.66
R7911:Gart UTSW 16 91638784 missense probably benign 0.23
R7992:Gart UTSW 16 91638784 missense probably benign 0.23
R8066:Gart UTSW 16 91639447 missense probably benign
Predicted Primers PCR Primer
(F):5'- TCAATCAACGGAACTGGAACGCTAC -3'
(R):5'- TAAGCCAAGGACAGGATCTCCTCC -3'

Sequencing Primer
(F):5'- GAACGCTACTGTTTCAAATGTGC -3'
(R):5'- GCTCTCTCAGGAAAGATAGTCCTC -3'
Posted On2013-07-11