Incidental Mutation 'R7575:Dip2c'
ID586357
Institutional Source Beutler Lab
Gene Symbol Dip2c
Ensembl Gene ENSMUSG00000048264
Gene Namedisco interacting protein 2 homolog C
Synonyms2900024P20Rik
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.385) question?
Stock #R7575 (G1)
Quality Score225.009
Status Not validated
Chromosome13
Chromosomal Location9276528-9668928 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 9628012 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 1165 (K1165E)
Ref Sequence ENSEMBL: ENSMUSP00000133806 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000166299] [ENSMUST00000169960] [ENSMUST00000174552]
Predicted Effect probably damaging
Transcript: ENSMUST00000166299
AA Change: K1166E

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000126827
Gene: ENSMUSG00000048264
AA Change: K1166E

DomainStartEndE-ValueType
DMAP_binding 7 120 3.55e-43 SMART
low complexity region 170 187 N/A INTRINSIC
low complexity region 275 287 N/A INTRINSIC
Pfam:AMP-binding 324 801 3.6e-23 PFAM
Pfam:AMP-binding 977 1451 1.5e-72 PFAM
low complexity region 1514 1526 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000169960
AA Change: K1136E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000131238
Gene: ENSMUSG00000048264
AA Change: K1136E

DomainStartEndE-ValueType
DMAP_binding 7 176 3.02e-37 SMART
low complexity region 226 243 N/A INTRINSIC
low complexity region 331 343 N/A INTRINSIC
Pfam:AMP-binding 380 637 5.9e-10 PFAM
SCOP:d1lci__ 675 875 2e-8 SMART
Pfam:AMP-binding 947 1421 1.2e-56 PFAM
low complexity region 1484 1496 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000174552
AA Change: K1165E

PolyPhen 2 Score 0.970 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000133806
Gene: ENSMUSG00000048264
AA Change: K1165E

DomainStartEndE-ValueType
DMAP_binding 7 120 3.55e-43 SMART
low complexity region 170 187 N/A INTRINSIC
low complexity region 275 287 N/A INTRINSIC
Pfam:AMP-binding 324 800 2.7e-20 PFAM
Pfam:AMP-binding 976 1450 1.3e-56 PFAM
low complexity region 1513 1525 N/A INTRINSIC
Predicted Effect
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the disco-interacting protein homolog 2 family. The protein shares strong similarity with a Drosophila protein which interacts with the transcription factor disco and is expressed in the nervous system. [provided by RefSeq, Oct 2008]
Allele List at MGI
Other mutations in this stock
Total: 91 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3425401B19Rik C T 14: 32,662,632 V459I probably benign Het
4921539E11Rik T C 4: 103,230,995 D439G probably damaging Het
Adam18 T C 8: 24,625,857 N607S possibly damaging Het
Adamtsl3 A T 7: 82,574,548 N1179I possibly damaging Het
Adarb1 A G 10: 77,303,295 F552S probably damaging Het
Ago1 T C 4: 126,453,908 E394G probably benign Het
Alb G A 5: 90,465,929 C224Y probably damaging Het
Alms1 T A 6: 85,622,159 H1322Q possibly damaging Het
Arhgef18 T G 8: 3,451,635 V643G probably damaging Het
Asah2 T C 19: 32,016,703 Q414R probably benign Het
Bbc3 G A 7: 16,312,367 R76H possibly damaging Het
BC027072 T A 17: 71,750,855 Q609L probably damaging Het
Bub1b T A 2: 118,641,158 S1000T possibly damaging Het
Bud23 A T 5: 135,061,128 Y70* probably null Het
C1d A G 11: 17,262,694 E13G probably damaging Het
Camk1 T A 6: 113,338,364 I158F probably damaging Het
Ccr2 A C 9: 124,105,806 D41A probably benign Het
Cdh18 G T 15: 23,400,597 E348* probably null Het
Col6a3 A G 1: 90,810,599 L1066P possibly damaging Het
Cyp11b1 T A 15: 74,839,313 D172V probably benign Het
Cyp2j8 A G 4: 96,470,548 I378T possibly damaging Het
Cys1 T A 12: 24,668,648 K69* probably null Het
Drd3 A T 16: 43,817,133 I232F probably benign Het
Dusp7 T C 9: 106,373,677 C334R probably damaging Het
Eppk1 A G 15: 76,111,242 S480P not run Het
Erc1 G T 6: 119,824,760 P99T possibly damaging Het
Fam170b C T 14: 32,836,198 P330L unknown Het
Fam173b C T 15: 31,606,040 A48V probably damaging Het
Fasn G T 11: 120,812,687 T1573K possibly damaging Het
Fras1 A T 5: 96,543,314 T130S probably benign Het
Fzd4 A G 7: 89,407,710 I322V possibly damaging Het
Gbp10 G A 5: 105,236,149 probably benign Het
Gdpd4 A T 7: 97,998,241 H365L probably benign Het
Gfy A G 7: 45,178,100 S191P probably benign Het
Ghr A T 15: 3,320,512 S395T probably damaging Het
Git2 C T 5: 114,766,489 R123H probably damaging Het
Htt A G 5: 34,905,643 D2873G probably damaging Het
Idua A T 5: 108,681,699 D476V probably damaging Het
Inppl1 G A 7: 101,828,482 R683W probably damaging Het
Ipp T C 4: 116,532,644 S466P probably benign Het
Iqgap2 A G 13: 95,661,623 V1058A probably damaging Het
Jmy A T 13: 93,464,595 Y434* probably null Het
Kmt2d CTGCTGCTG CTGCTGCTGATGCTGCTG 15: 98,849,611 probably benign Het
Mogs T G 6: 83,115,835 S85R probably damaging Het
Mroh2b A T 15: 4,934,605 D863V probably damaging Het
Mtmr10 A T 7: 64,297,465 I43F probably damaging Het
Mtr T C 13: 12,199,077 D903G probably benign Het
Ncor1 A G 11: 62,383,256 V186A probably benign Het
Notch3 C T 17: 32,154,819 D472N possibly damaging Het
Olfr1062 A G 2: 86,423,238 F146S probably benign Het
Olfr1294 A T 2: 111,538,252 F12L probably damaging Het
Olfr1502 T C 19: 13,862,017 S75P probably damaging Het
Olfr780 T C 10: 129,321,859 F79L probably damaging Het
Oxr1 T G 15: 41,823,362 L547V possibly damaging Het
Pappa2 A T 1: 158,814,530 C1319S probably damaging Het
Papss1 A C 3: 131,643,096 K623N probably damaging Het
Parp4 T C 14: 56,637,918 F1198S probably benign Het
Pcnt A T 10: 76,389,252 V1806D probably benign Het
Pitx2 A T 3: 129,215,726 H98L probably damaging Het
Polq C A 16: 37,091,134 D2410E probably benign Het
Prdm9 C T 17: 15,544,628 C630Y probably damaging Het
Preb A T 5: 30,958,495 D201E probably damaging Het
Rasa3 A T 8: 13,595,887 I151N possibly damaging Het
Rasgrp2 T A 19: 6,404,367 S147T probably damaging Het
Rev3l A G 10: 39,821,445 D646G possibly damaging Het
Sdc1 A G 12: 8,790,619 E128G probably damaging Het
Slamf7 A C 1: 171,639,194 C148G probably damaging Het
Slc19a2 T C 1: 164,257,122 S194P probably damaging Het
Spata31 C T 13: 64,922,912 P958L unknown Het
Sprr2b CTGAGCCTTGTCCTCCTCCAAAGTGCCCTGAGCCTTGTCCTCCCCCAGTATGCTGTGAGCCTTGTCCTCCTCCAAAGTGCCCTGAGCCTTGTCCTCCCCCAGTATGCTGTGAGCCTTGTCCTCC CTGAGCCTTGTCCTCCTCCAAAGTGCCCTGAGCCTTGTCCTCCCCCAGTATGCTGTGAGCCTTGTCCTCC 3: 92,317,519 probably benign Het
Stradb A G 1: 58,988,580 I90V probably benign Het
Tas2r134 A G 2: 51,628,154 D215G probably damaging Het
Tbc1d4 T C 14: 101,447,589 K1209E probably damaging Het
Thbs1 A G 2: 118,122,928 D942G probably damaging Het
Tmem107 C T 11: 69,072,807 P139S probably benign Het
Tmem216 A T 19: 10,551,902 M40K probably benign Het
Tpte A G 8: 22,355,482 Y516C probably damaging Het
Trim54 G A 5: 31,134,087 G184D possibly damaging Het
Try5 A T 6: 41,311,814 L157Q probably benign Het
Ubqlnl G A 7: 104,148,490 A600V probably damaging Het
Uhrf2 C A 19: 30,071,368 P258Q probably damaging Het
Ush2a A T 1: 188,822,688 E3554D possibly damaging Het
Usp40 A C 1: 87,949,960 L1158W probably damaging Het
Vmn1r121 T A 7: 21,098,273 R81* probably null Het
Vmn1r203 C A 13: 22,524,418 T123K probably benign Het
Vmn2r101 T C 17: 19,611,392 V550A probably benign Het
Wdr49 A T 3: 75,450,886 M184K probably damaging Het
Wipi2 A G 5: 142,658,232 N123S probably damaging Het
Zbtb14 T C 17: 69,387,447 F47L probably damaging Het
Zc3h7b C A 15: 81,777,885 S385* probably null Het
Zhx2 T A 15: 57,823,262 F676I probably damaging Het
Other mutations in Dip2c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00392:Dip2c APN 13 9493108 missense probably damaging 0.97
IGL00426:Dip2c APN 13 9606515 missense probably damaging 1.00
IGL00503:Dip2c APN 13 9567898 missense probably damaging 1.00
IGL00586:Dip2c APN 13 9610755 missense probably damaging 1.00
IGL01306:Dip2c APN 13 9575143 missense possibly damaging 0.72
IGL01580:Dip2c APN 13 9637088 splice site probably null
IGL01985:Dip2c APN 13 9553267 splice site probably benign
IGL02060:Dip2c APN 13 9622630 missense probably damaging 0.98
IGL02122:Dip2c APN 13 9506659 missense possibly damaging 0.48
IGL02170:Dip2c APN 13 9606335 missense probably benign 0.03
IGL02211:Dip2c APN 13 9610847 missense probably damaging 1.00
IGL02755:Dip2c APN 13 9550320 critical splice donor site probably null
IGL02836:Dip2c APN 13 9610790 missense probably damaging 0.98
IGL02935:Dip2c APN 13 9662146 missense probably damaging 1.00
IGL03032:Dip2c APN 13 9551778 missense probably damaging 1.00
ANU23:Dip2c UTSW 13 9575143 missense possibly damaging 0.72
P0038:Dip2c UTSW 13 9646982 missense probably damaging 1.00
R0009:Dip2c UTSW 13 9621903 missense probably damaging 1.00
R0268:Dip2c UTSW 13 9637150 missense probably damaging 1.00
R0271:Dip2c UTSW 13 9615775 missense probably damaging 1.00
R0306:Dip2c UTSW 13 9604599 missense probably benign 0.09
R0415:Dip2c UTSW 13 9568289 splice site probably benign
R0519:Dip2c UTSW 13 9563208 missense probably damaging 1.00
R0557:Dip2c UTSW 13 9553459 missense possibly damaging 0.81
R0964:Dip2c UTSW 13 9568663 missense probably benign 0.43
R0973:Dip2c UTSW 13 9576908 missense probably damaging 0.99
R0973:Dip2c UTSW 13 9576908 missense probably damaging 0.99
R0974:Dip2c UTSW 13 9576908 missense probably damaging 0.99
R1101:Dip2c UTSW 13 9634744 missense probably damaging 1.00
R1171:Dip2c UTSW 13 9493126 missense possibly damaging 0.89
R1403:Dip2c UTSW 13 9553264 splice site probably null
R1403:Dip2c UTSW 13 9553264 splice site probably null
R1432:Dip2c UTSW 13 9553304 missense probably damaging 0.99
R1481:Dip2c UTSW 13 9551866 critical splice donor site probably null
R1588:Dip2c UTSW 13 9665864 missense probably damaging 1.00
R1721:Dip2c UTSW 13 9659368 missense probably damaging 1.00
R1726:Dip2c UTSW 13 9575428 missense probably damaging 1.00
R1867:Dip2c UTSW 13 9621949 missense possibly damaging 0.55
R1909:Dip2c UTSW 13 9533350 missense probably benign 0.00
R2013:Dip2c UTSW 13 9567846 nonsense probably null
R2022:Dip2c UTSW 13 9551800 missense probably damaging 1.00
R2517:Dip2c UTSW 13 9609005 missense probably damaging 1.00
R3746:Dip2c UTSW 13 9601473 missense probably damaging 1.00
R3794:Dip2c UTSW 13 9604561 missense probably damaging 0.99
R3884:Dip2c UTSW 13 9551858 missense probably damaging 1.00
R4019:Dip2c UTSW 13 9614365 missense probably damaging 0.99
R4110:Dip2c UTSW 13 9637101 missense probably damaging 1.00
R4111:Dip2c UTSW 13 9637101 missense probably damaging 1.00
R4113:Dip2c UTSW 13 9637101 missense probably damaging 1.00
R4256:Dip2c UTSW 13 9609056 missense probably damaging 1.00
R4300:Dip2c UTSW 13 9610711 missense probably damaging 1.00
R4494:Dip2c UTSW 13 9571062 missense possibly damaging 0.64
R4739:Dip2c UTSW 13 9533339 missense probably damaging 0.98
R4812:Dip2c UTSW 13 9637130 nonsense probably null
R4814:Dip2c UTSW 13 9536860 missense probably benign 0.07
R4816:Dip2c UTSW 13 9575150 missense probably benign 0.37
R4828:Dip2c UTSW 13 9560679 missense probably damaging 1.00
R4915:Dip2c UTSW 13 9621869 splice site probably null
R4917:Dip2c UTSW 13 9621869 splice site probably null
R4932:Dip2c UTSW 13 9623972 missense probably damaging 0.99
R4993:Dip2c UTSW 13 9575223 nonsense probably null
R5043:Dip2c UTSW 13 9551827 missense possibly damaging 0.80
R5349:Dip2c UTSW 13 9622653 missense probably damaging 1.00
R5744:Dip2c UTSW 13 9568405 missense probably damaging 1.00
R5840:Dip2c UTSW 13 9506676 missense possibly damaging 0.68
R6110:Dip2c UTSW 13 9623766 missense probably damaging 1.00
R6160:Dip2c UTSW 13 9533254 missense probably benign 0.01
R6161:Dip2c UTSW 13 9647007 missense probably damaging 1.00
R6477:Dip2c UTSW 13 9623760 missense probably damaging 1.00
R6522:Dip2c UTSW 13 9575228 critical splice donor site probably null
R6603:Dip2c UTSW 13 9654588 splice site probably null
R6658:Dip2c UTSW 13 9493177 critical splice donor site probably null
R6672:Dip2c UTSW 13 9567830 critical splice acceptor site probably null
R6697:Dip2c UTSW 13 9621913 missense probably damaging 1.00
R6991:Dip2c UTSW 13 9551860 nonsense probably null
R6991:Dip2c UTSW 13 9634832 missense probably damaging 1.00
R7018:Dip2c UTSW 13 9659278 missense probably damaging 1.00
R7053:Dip2c UTSW 13 9610704 missense probably damaging 1.00
R7102:Dip2c UTSW 13 9604536 missense probably benign 0.01
R7171:Dip2c UTSW 13 9506648 missense probably benign 0.34
R7371:Dip2c UTSW 13 9592749 missense probably benign 0.02
R7395:Dip2c UTSW 13 9614377 missense probably damaging 1.00
R7489:Dip2c UTSW 13 9533312 missense probably damaging 0.99
R7642:Dip2c UTSW 13 9622705 critical splice donor site probably null
R7687:Dip2c UTSW 13 9604581 missense probably benign 0.00
R7699:Dip2c UTSW 13 9659311 missense probably benign 0.00
R7700:Dip2c UTSW 13 9659311 missense probably benign 0.00
R7715:Dip2c UTSW 13 9614391 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCAGCCTTTCTAGGATAATGTGACC -3'
(R):5'- TTGGCCAAAGATCCAGAAGG -3'

Sequencing Primer
(F):5'- CCTTTCTAGGATAATGTGACCCAGAC -3'
(R):5'- TCCAGAAGGGAAGGTATATGGTTTC -3'
Posted On2019-10-24