Incidental Mutation 'R0620:H2-DMa'
ID 58637
Institutional Source Beutler Lab
Gene Symbol H2-DMa
Ensembl Gene ENSMUSG00000037649
Gene Name histocompatibility 2, class II, locus DMa
Synonyms H2-M alpha, H2-Ma, H-2Ma
MMRRC Submission 038809-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.228) question?
Stock # R0620 (G1)
Quality Score 225
Status Validated
Chromosome 17
Chromosomal Location 34135182-34139101 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 34137960 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Methionine at position 144 (T144M)
Ref Sequence ENSEMBL: ENSMUSP00000037088 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042121]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000042121
AA Change: T144M

PolyPhen 2 Score 0.965 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000037088
Gene: ENSMUSG00000037649
AA Change: T144M

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
MHC_II_alpha 42 123 2.83e-19 SMART
IGc1 142 212 5.82e-23 SMART
transmembrane domain 231 253 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173706
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173907
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 99.0%
  • 10x: 97.8%
  • 20x: 96.1%
Validation Efficiency 100% (74/74)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] HLA-DMA belongs to the HLA class II alpha chain paralogues. This class II molecule is a heterodimer consisting of an alpha (DMA) and a beta chain (DMB), both anchored in the membrane. It is located in intracellular vesicles. DM plays a central role in the peptide loading of MHC class II molecules by helping to release the CLIP molecule from the peptide binding site. Class II molecules are expressed in antigen presenting cells (APC: B lymphocytes, dendritic cells, macrophages). The alpha chain is approximately 33-35 kDa and its gene contains 5 exons. Exon one encodes the leader peptide, exons 2 and 3 encode the two extracellular domains, exon 4 encodes the transmembrane domain and the cytoplasmic tail. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations exhibit impaired antigen presenting cell function, poor IgG responses to T-dependent antigens, reduced numbers of mature CD4+ T cells, and increased susceptibility to Leishmania major infection. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810474O19Rik A T 6: 149,328,375 Q973L probably damaging Het
Adamts9 T C 6: 92,858,113 T679A possibly damaging Het
Ahr T C 12: 35,508,194 T276A probably benign Het
Akap9 A T 5: 4,064,136 Q3138H probably damaging Het
Armt1 T A 10: 4,432,689 F7I probably benign Het
B3galt2 A G 1: 143,646,140 R5G probably damaging Het
Bod1l T C 5: 41,801,233 N2750S probably benign Het
Cadps2 T A 6: 23,583,396 E365V probably damaging Het
Cd200r3 T A 16: 44,957,717 probably null Het
Cst7 T A 2: 150,575,886 probably benign Het
Defb30 A T 14: 63,049,763 probably benign Het
Dido1 C T 2: 180,659,851 G2087S probably benign Het
Dio2 A G 12: 90,738,071 Y72H probably benign Het
Dnah11 C T 12: 117,987,469 E3035K probably damaging Het
Dnajb13 T C 7: 100,503,249 K287E possibly damaging Het
Dnajc11 G A 4: 151,973,628 V244I possibly damaging Het
Ect2 C T 3: 27,139,652 A226T probably damaging Het
Ercc8 G A 13: 108,174,061 probably null Het
Fam120b T A 17: 15,402,927 M389K probably benign Het
Fam151a A G 4: 106,747,931 M497V probably benign Het
Fam186b C A 15: 99,280,128 G439V probably benign Het
Fank1 A G 7: 133,876,765 Y185C probably damaging Het
Gart T C 16: 91,630,602 probably benign Het
Glb1l T C 1: 75,199,720 Y572C probably damaging Het
Gm11563 C T 11: 99,658,437 A164T unknown Het
Gnb4 C T 3: 32,591,207 V112I probably benign Het
Gsdmc3 T A 15: 63,859,693 D330V probably damaging Het
Haus6 A T 4: 86,583,514 F707I possibly damaging Het
Hmcn1 T A 1: 150,594,016 T4971S probably benign Het
Ints6 A T 14: 62,696,759 F766L probably benign Het
Kdm5d T A Y: 927,330 M650K probably damaging Het
Kif21b T C 1: 136,159,428 F881S possibly damaging Het
Klrk1 C A 6: 129,614,635 Q176H possibly damaging Het
Ky T C 9: 102,537,621 V244A probably benign Het
Mia2 T A 12: 59,154,419 L191M possibly damaging Het
Miga2 T A 2: 30,381,744 probably benign Het
Mtss1l C T 8: 110,737,948 P322S probably damaging Het
Nalcn A G 14: 123,299,141 probably benign Het
Ncbp3 T A 11: 73,049,845 probably benign Het
Nprl3 G A 11: 32,234,876 L378F probably damaging Het
Ntrk2 A T 13: 58,846,821 M184L probably benign Het
Olfr311 T G 11: 58,841,443 C110G probably damaging Het
Olfr738 G T 14: 50,413,697 C51F probably benign Het
Osbpl9 T C 4: 109,083,128 E287G probably damaging Het
Parva T C 7: 112,576,411 F250L probably damaging Het
Pcdhb11 C T 18: 37,421,811 Q65* probably null Het
Phtf1 A G 3: 103,993,765 T377A probably damaging Het
Pkp4 G A 2: 59,322,643 V612I possibly damaging Het
Plscr2 C A 9: 92,287,654 S52R probably benign Het
Pnisr C T 4: 21,874,092 probably benign Het
Pole2 A C 12: 69,209,879 S291A probably damaging Het
Ppp2r5d A G 17: 46,684,018 F586L probably benign Het
Prrx1 G A 1: 163,257,816 R182C probably damaging Het
Ptprs A G 17: 56,429,103 I110T possibly damaging Het
Rasgrf2 G A 13: 91,919,817 probably benign Het
Riox2 T C 16: 59,491,892 V464A probably benign Het
Robo2 A G 16: 73,967,802 V646A possibly damaging Het
Ros1 T A 10: 52,118,348 I1279F probably damaging Het
Siglec1 G A 2: 131,074,268 T1254M probably benign Het
Snx7 T C 3: 117,846,675 N62D probably damaging Het
Sp100 G A 1: 85,659,867 probably null Het
Stil A T 4: 115,007,159 I86L possibly damaging Het
Tbc1d16 T A 11: 119,209,038 D170V probably benign Het
Tmem2 T A 19: 21,817,971 S743T probably benign Het
Trappc13 G A 13: 104,161,081 T105M probably damaging Het
Trhr T A 15: 44,229,500 S378T probably benign Het
Ttc7b T C 12: 100,500,073 probably null Het
Vegfc A T 8: 54,157,139 Y110F probably benign Het
Vmn1r184 C A 7: 26,267,177 P116H possibly damaging Het
Vmn2r5 A T 3: 64,503,814 C444* probably null Het
Zfp341 A G 2: 154,634,273 E460G possibly damaging Het
Zfp819 T A 7: 43,616,444 V41E probably benign Het
Other mutations in H2-DMa
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03286:H2-DMa APN 17 34137109 splice site probably null
R0422:H2-DMa UTSW 17 34137947 missense probably damaging 1.00
R1240:H2-DMa UTSW 17 34138406 critical splice acceptor site probably null
R1483:H2-DMa UTSW 17 34135750 missense possibly damaging 0.61
R1656:H2-DMa UTSW 17 34138142 missense possibly damaging 0.92
R1657:H2-DMa UTSW 17 34137399 critical splice donor site probably null
R1696:H2-DMa UTSW 17 34138413 missense probably benign 0.44
R2884:H2-DMa UTSW 17 34137147 missense probably damaging 1.00
R2886:H2-DMa UTSW 17 34137147 missense probably damaging 1.00
R5024:H2-DMa UTSW 17 34138487 missense possibly damaging 0.77
R5236:H2-DMa UTSW 17 34137939 missense probably damaging 1.00
R5632:H2-DMa UTSW 17 34138001 missense probably benign 0.14
R6358:H2-DMa UTSW 17 34137984 missense probably damaging 1.00
R6423:H2-DMa UTSW 17 34137196 missense probably benign 0.05
R7033:H2-DMa UTSW 17 34136997 splice site probably null
R7387:H2-DMa UTSW 17 34138127 missense probably damaging 1.00
R8060:H2-DMa UTSW 17 34137285 missense probably benign 0.05
R8504:H2-DMa UTSW 17 34138442 missense probably damaging 1.00
R8813:H2-DMa UTSW 17 34135760 critical splice donor site probably benign
Predicted Primers PCR Primer
(F):5'- AAGCCAGTGTCAGATGCCAACC -3'
(R):5'- CGTGTGTCACAGTGCAGGAGTAAAG -3'

Sequencing Primer
(F):5'- CAGTTTTTGCCGGGAAGACC -3'
(R):5'- AGGTCAAAGGGTTCCGGTG -3'
Posted On 2013-07-11