Incidental Mutation 'R7576:Fmn1'
ID586398
Institutional Source Beutler Lab
Gene Symbol Fmn1
Ensembl Gene ENSMUSG00000044042
Gene Nameformin 1
SynonymsFmn, formin-1
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.308) question?
Stock #R7576 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location113327736-113716767 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 113365008 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 351 (D351G)
Ref Sequence ENSEMBL: ENSMUSP00000125052 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099576] [ENSMUST00000102547] [ENSMUST00000161731]
Predicted Effect unknown
Transcript: ENSMUST00000099576
AA Change: D351G
SMART Domains Protein: ENSMUSP00000097171
Gene: ENSMUSG00000044042
AA Change: D351G

DomainStartEndE-ValueType
low complexity region 159 173 N/A INTRINSIC
Blast:FH2 352 861 N/A BLAST
SCOP:d1jvr__ 894 925 2e-3 SMART
FH2 983 1388 1.16e-137 SMART
Predicted Effect unknown
Transcript: ENSMUST00000102547
AA Change: D351G
SMART Domains Protein: ENSMUSP00000099606
Gene: ENSMUSG00000044042
AA Change: D351G

DomainStartEndE-ValueType
low complexity region 159 173 N/A INTRINSIC
Blast:FH2 352 861 N/A BLAST
SCOP:d1jvr__ 894 925 2e-3 SMART
FH2 983 1424 1.03e-134 SMART
Predicted Effect unknown
Transcript: ENSMUST00000161731
AA Change: D351G
SMART Domains Protein: ENSMUSP00000125052
Gene: ENSMUSG00000044042
AA Change: D351G

DomainStartEndE-ValueType
low complexity region 159 173 N/A INTRINSIC
Blast:FH2 352 619 1e-62 BLAST
Blast:FH2 625 765 3e-53 BLAST
SCOP:d1jvr__ 796 827 2e-3 SMART
FH2 885 1290 1.16e-137 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the formin homology family and encodes a protein that has a role in the formation of adherens junction and the polymerization of linear actin cables. The homologous gene in mouse is associated with limb deformity. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Sep 2015]
PHENOTYPE: Homozygotes for spontaneous, irradiation-induced, and transgene-insertional mutations show severe syndactyly and oligodactyly of the feet, abnormal long bones (including radius-ulna fusions), and reduced or absent kidneys. Many mutants survive and breed. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ahdc1 A T 4: 133,065,002 S1185C possibly damaging Het
Akap9 C G 5: 3,968,745 H1109D probably benign Het
Alpk2 T C 18: 65,306,816 D502G possibly damaging Het
Bcl2 A G 1: 106,712,423 V153A possibly damaging Het
Brinp3 A T 1: 146,901,563 S583C probably damaging Het
Calr4 A T 4: 109,238,964 Q113L probably benign Het
Carm1 T G 9: 21,586,536 probably null Het
Ccdc30 A G 4: 119,349,866 L353P probably damaging Het
Ccdc91 C G 6: 147,590,459 Q280E unknown Het
Cdk5rap2 T C 4: 70,266,872 T1114A probably benign Het
Enpep T A 3: 129,284,091 T626S probably benign Het
Epcam T C 17: 87,640,293 S64P probably damaging Het
Erc1 G T 6: 119,824,760 P99T possibly damaging Het
Fastkd1 A G 2: 69,694,644 L636S probably damaging Het
Fndc8 T G 11: 82,897,574 S77A probably damaging Het
Gbp10 G A 5: 105,236,149 probably benign Het
Gemin6 T A 17: 80,225,726 Y29* probably null Het
Gja8 T C 3: 96,919,893 E151G probably benign Het
Gje1 A G 10: 14,716,757 Y94H probably damaging Het
Glt6d1 A G 2: 25,814,122 F26S probably benign Het
Gltpd2 T A 11: 70,519,480 probably null Het
Gm10153 A C 7: 142,190,122 C70G unknown Het
Gm28729 G A 9: 96,494,357 T368M probably damaging Het
Gm4559 A G 7: 142,273,940 C142R unknown Het
Golm1 T C 13: 59,645,106 N195S probably benign Het
Hectd4 A T 5: 121,349,459 S3506C possibly damaging Het
Hnrnpll G A 17: 80,044,514 S334L possibly damaging Het
Ighv7-3 A T 12: 114,153,245 I99N possibly damaging Het
Igkv8-24 A G 6: 70,217,018 S69P not run Het
Ilvbl A T 10: 78,583,697 H537L possibly damaging Het
Lama1 G A 17: 67,782,041 G1569D Het
Lin7b A T 7: 45,369,225 Y118* probably null Het
Mansc1 T A 6: 134,610,711 S168C possibly damaging Het
Mast3 A G 8: 70,781,194 V969A probably damaging Het
Muc4 C T 16: 32,754,500 T1458I probably benign Het
Myh10 A G 11: 68,802,166 E1429G probably damaging Het
Narfl A C 17: 25,778,970 T154P probably damaging Het
Neurod1 G T 2: 79,454,345 Y231* probably null Het
Nrxn2 G T 19: 6,531,510 E1492* probably null Het
Nwd2 A G 5: 63,807,393 Q1440R probably benign Het
Olfr1038-ps A G 2: 86,122,376 Y151C probably damaging Het
Olfr1404 A G 1: 173,215,971 T107A probably benign Het
Olfr5 T A 7: 6,480,331 N275I probably damaging Het
Pacs1 T A 19: 5,145,120 T479S probably benign Het
Pds5b A G 5: 150,778,261 K786E probably damaging Het
Pigp A G 16: 94,370,405 L9P probably benign Het
Plec C T 15: 76,187,746 R707Q unknown Het
Ppef2 T A 5: 92,253,134 H9L possibly damaging Het
Ppid T A 3: 79,600,391 C296S probably damaging Het
Ppp2r5b T G 19: 6,228,484 E465A possibly damaging Het
Ppp4r4 A G 12: 103,596,449 N559S probably damaging Het
Ptprt T C 2: 161,607,305 T873A possibly damaging Het
Rbpms A G 8: 33,866,388 V28A probably damaging Het
Retreg2 A G 1: 75,144,688 M203V probably damaging Het
Rfx4 A G 10: 84,863,349 E367G probably damaging Het
Robo1 C T 16: 72,970,181 P414S probably damaging Het
Sac3d1 T A 19: 6,116,148 E410D probably damaging Het
Scgb2b19 A T 7: 33,279,786 C24S possibly damaging Het
She T C 3: 89,831,612 F37L probably damaging Het
Slc5a2 G A 7: 128,265,805 V37I probably damaging Het
Smyd4 T A 11: 75,390,206 D168E probably benign Het
Ssc5d C A 7: 4,928,573 P260T probably damaging Het
Steap2 A G 5: 5,677,406 F310L probably benign Het
Tctn1 A T 5: 122,248,008 I347N probably damaging Het
Tmtc2 A G 10: 105,370,621 L271P probably damaging Het
Tns3 T A 11: 8,541,192 M122L possibly damaging Het
Ubr7 T G 12: 102,769,139 C286G probably damaging Het
Usp16 T C 16: 87,479,300 S509P probably benign Het
Usp44 A G 10: 93,846,428 T247A probably damaging Het
Vmn2r92 A C 17: 18,167,359 M209L probably benign Het
Wdr34 C T 2: 30,048,778 R31Q probably benign Het
Zc3h6 C T 2: 129,014,553 P518S probably damaging Het
Zfp229 A G 17: 21,745,299 H170R probably damaging Het
Zfp960 A G 17: 17,087,965 T314A probably benign Het
Other mutations in Fmn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00495:Fmn1 APN 2 113444467 intron probably benign
IGL01520:Fmn1 APN 2 113444368 intron probably benign
IGL02039:Fmn1 APN 2 113365080 missense unknown
IGL02222:Fmn1 APN 2 113593109 missense probably damaging 1.00
IGL02238:Fmn1 APN 2 113582125 missense possibly damaging 0.90
IGL02373:Fmn1 APN 2 113364126 missense unknown
IGL02490:Fmn1 APN 2 113529472 splice site probably benign
IGL02506:Fmn1 APN 2 113525295 missense unknown
IGL02684:Fmn1 APN 2 113525277 missense unknown
IGL03008:Fmn1 APN 2 113365100 missense unknown
IGL03058:Fmn1 APN 2 113441814 intron probably benign
IGL03076:Fmn1 APN 2 113584092 missense probably damaging 0.99
FR4304:Fmn1 UTSW 2 113525774 small insertion probably benign
FR4304:Fmn1 UTSW 2 113525783 small insertion probably benign
FR4342:Fmn1 UTSW 2 113525783 small insertion probably benign
FR4589:Fmn1 UTSW 2 113525773 small insertion probably benign
FR4589:Fmn1 UTSW 2 113525774 small insertion probably benign
FR4737:Fmn1 UTSW 2 113525778 small insertion probably benign
FR4737:Fmn1 UTSW 2 113525781 small insertion probably benign
FR4737:Fmn1 UTSW 2 113525784 small insertion probably benign
R0349:Fmn1 UTSW 2 113365796 missense unknown
R0452:Fmn1 UTSW 2 113636779 missense possibly damaging 0.46
R0529:Fmn1 UTSW 2 113707853 splice site probably benign
R1215:Fmn1 UTSW 2 113693030 nonsense probably null
R1471:Fmn1 UTSW 2 113693094 missense possibly damaging 0.95
R1489:Fmn1 UTSW 2 113365212 missense unknown
R1491:Fmn1 UTSW 2 113596369 missense probably damaging 1.00
R1551:Fmn1 UTSW 2 113525862 missense possibly damaging 0.70
R1558:Fmn1 UTSW 2 113693118 missense possibly damaging 0.46
R1588:Fmn1 UTSW 2 113365698 missense unknown
R1602:Fmn1 UTSW 2 113525623 missense unknown
R1690:Fmn1 UTSW 2 113525482 missense unknown
R1772:Fmn1 UTSW 2 113365355 missense unknown
R1867:Fmn1 UTSW 2 113709438 missense probably damaging 1.00
R1923:Fmn1 UTSW 2 113429721 intron probably benign
R1941:Fmn1 UTSW 2 113365143 missense unknown
R2019:Fmn1 UTSW 2 113364480 missense unknown
R2140:Fmn1 UTSW 2 113595048 missense probably benign 0.45
R2164:Fmn1 UTSW 2 113365617 missense unknown
R2395:Fmn1 UTSW 2 113365181 missense unknown
R2999:Fmn1 UTSW 2 113365094 missense unknown
R3405:Fmn1 UTSW 2 113364348 missense unknown
R3407:Fmn1 UTSW 2 113365055 missense unknown
R3771:Fmn1 UTSW 2 113582118 missense probably damaging 1.00
R3772:Fmn1 UTSW 2 113582118 missense probably damaging 1.00
R3773:Fmn1 UTSW 2 113582118 missense probably damaging 1.00
R3777:Fmn1 UTSW 2 113365122 missense unknown
R4166:Fmn1 UTSW 2 113636735 missense probably benign 0.33
R4477:Fmn1 UTSW 2 113444399 intron probably benign
R4614:Fmn1 UTSW 2 113365149 missense unknown
R4701:Fmn1 UTSW 2 113584071 missense possibly damaging 0.76
R4867:Fmn1 UTSW 2 113584120 critical splice donor site probably null
R5063:Fmn1 UTSW 2 113364921 missense unknown
R5224:Fmn1 UTSW 2 113365125 missense unknown
R5510:Fmn1 UTSW 2 113596369 missense probably damaging 1.00
R6083:Fmn1 UTSW 2 113364303 missense unknown
R6234:Fmn1 UTSW 2 113365655 missense unknown
R6266:Fmn1 UTSW 2 113596338 missense probably damaging 1.00
R6764:Fmn1 UTSW 2 113525215 missense unknown
R7054:Fmn1 UTSW 2 113365008 missense unknown
R7311:Fmn1 UTSW 2 113525680 missense unknown
R7439:Fmn1 UTSW 2 113441611 missense unknown
R7440:Fmn1 UTSW 2 113441611 missense unknown
R7441:Fmn1 UTSW 2 113441611 missense unknown
R7444:Fmn1 UTSW 2 113441611 missense unknown
R7461:Fmn1 UTSW 2 113364071 missense unknown
R7526:Fmn1 UTSW 2 113688134 missense probably damaging 0.99
R7540:Fmn1 UTSW 2 113529310 splice site probably null
R7657:Fmn1 UTSW 2 113525193 missense unknown
R7669:Fmn1 UTSW 2 113365477 missense unknown
R7713:Fmn1 UTSW 2 113525814 missense unknown
R7841:Fmn1 UTSW 2 113529465 critical splice donor site probably null
R7924:Fmn1 UTSW 2 113529465 critical splice donor site probably null
R8041:Fmn1 UTSW 2 113364594 missense unknown
RF003:Fmn1 UTSW 2 113525786 small insertion probably benign
RF023:Fmn1 UTSW 2 113525786 small insertion probably benign
Z1088:Fmn1 UTSW 2 113441925 intron probably benign
Predicted Primers PCR Primer
(F):5'- AATGTGTCTGAAAGCCATGGG -3'
(R):5'- CTCTATCACCTTGCGGAGAAC -3'

Sequencing Primer
(F):5'- TGGGAAACATGCAGGGGC -3'
(R):5'- CTTGCGGAGAACCTTGTTCACAG -3'
Posted On2019-10-24