Incidental Mutation 'R7576:Ptprt'
ID 586400
Institutional Source Beutler Lab
Gene Symbol Ptprt
Ensembl Gene ENSMUSG00000053141
Gene Name protein tyrosine phosphatase receptor type T
Synonyms RPTPrho
MMRRC Submission 045661-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.080) question?
Stock # R7576 (G1)
Quality Score 225.009
Status Not validated
Chromosome 2
Chromosomal Location 161363910-162503067 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 161449225 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 873 (T873A)
Ref Sequence ENSEMBL: ENSMUSP00000105067 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000109441] [ENSMUST00000109442] [ENSMUST00000109443] [ENSMUST00000109445]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000109441
AA Change: T873A

PolyPhen 2 Score 0.883 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000105067
Gene: ENSMUSG00000053141
AA Change: T873A

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
MAM 31 195 2.21e-71 SMART
IG 202 290 3.94e-2 SMART
FN3 292 375 3.35e-3 SMART
FN3 388 477 4.06e-2 SMART
FN3 489 579 1.2e-4 SMART
transmembrane domain 753 772 N/A INTRINSIC
PTPc 882 1159 3.64e-129 SMART
PTPc 1188 1453 4.24e-98 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000109442
AA Change: T892A

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000105068
Gene: ENSMUSG00000053141
AA Change: T892A

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
MAM 31 195 2.21e-71 SMART
IG 202 290 3.94e-2 SMART
FN3 292 375 3.35e-3 SMART
FN3 388 477 4.06e-2 SMART
FN3 489 579 1.2e-4 SMART
low complexity region 738 749 N/A INTRINSIC
transmembrane domain 772 791 N/A INTRINSIC
PTPc 901 1158 5.56e-134 SMART
PTPc 1187 1452 4.24e-98 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000109443
AA Change: T883A

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000105069
Gene: ENSMUSG00000053141
AA Change: T883A

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
MAM 31 195 2.21e-71 SMART
IG 202 290 3.94e-2 SMART
FN3 292 375 3.35e-3 SMART
FN3 388 477 4.06e-2 SMART
FN3 489 579 1.2e-4 SMART
low complexity region 778 792 N/A INTRINSIC
PTPc 892 1149 5.56e-134 SMART
PTPc 1178 1443 4.24e-98 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000109445
AA Change: T873A

PolyPhen 2 Score 0.891 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000105071
Gene: ENSMUSG00000053141
AA Change: T873A

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
MAM 31 195 2.21e-71 SMART
IG 202 290 3.94e-2 SMART
FN3 292 375 3.35e-3 SMART
FN3 388 477 4.06e-2 SMART
FN3 489 579 1.2e-4 SMART
transmembrane domain 753 772 N/A INTRINSIC
PTPc 882 1139 5.56e-134 SMART
PTPc 1168 1433 4.24e-98 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitotic cycle, and oncogenic transformation. This PTP possesses an extracellular region, a single transmembrane region, and two tandem intracellular catalytic domains, and thus represents a receptor-type PTP. The extracellular region contains a meprin-A5 antigen-PTP (MAM) domain, Ig-like and fibronectin type III-like repeats. The protein domain structure and the expression pattern of the mouse counterpart of this PTP suggest its roles in both signal transduction and cellular adhesion in the central nervous system. Two alternatively spliced transcript variants of this gene, which encode distinct proteins, have been reported. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele are highly susceptible to carcinogen azoxymethane-induced colon tumors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ahdc1 A T 4: 132,792,313 (GRCm39) S1185C possibly damaging Het
Akap9 C G 5: 4,018,745 (GRCm39) H1109D probably benign Het
Alpk2 T C 18: 65,439,887 (GRCm39) D502G possibly damaging Het
Bcl2 A G 1: 106,640,153 (GRCm39) V153A possibly damaging Het
Brinp3 A T 1: 146,777,301 (GRCm39) S583C probably damaging Het
Calr4 A T 4: 109,096,161 (GRCm39) Q113L probably benign Het
Carm1 T G 9: 21,497,832 (GRCm39) probably null Het
Ccdc30 A G 4: 119,207,063 (GRCm39) L353P probably damaging Het
Ccdc91 C G 6: 147,491,957 (GRCm39) Q280E unknown Het
Cdk5rap2 T C 4: 70,185,109 (GRCm39) T1114A probably benign Het
Ciao3 A C 17: 25,997,944 (GRCm39) T154P probably damaging Het
Dync2i2 C T 2: 29,938,790 (GRCm39) R31Q probably benign Het
Enpep T A 3: 129,077,740 (GRCm39) T626S probably benign Het
Epcam T C 17: 87,947,721 (GRCm39) S64P probably damaging Het
Erc1 G T 6: 119,801,721 (GRCm39) P99T possibly damaging Het
Fastkd1 A G 2: 69,524,988 (GRCm39) L636S probably damaging Het
Fmn1 A G 2: 113,195,353 (GRCm39) D351G unknown Het
Fndc8 T G 11: 82,788,400 (GRCm39) S77A probably damaging Het
Gbp10 G A 5: 105,384,015 (GRCm39) probably benign Het
Gemin6 T A 17: 80,533,155 (GRCm39) Y29* probably null Het
Gja8 T C 3: 96,827,209 (GRCm39) E151G probably benign Het
Gje1 A G 10: 14,592,501 (GRCm39) Y94H probably damaging Het
Glt6d1 A G 2: 25,704,134 (GRCm39) F26S probably benign Het
Gltpd2 T A 11: 70,410,306 (GRCm39) probably null Het
Gm10153 A C 7: 141,743,859 (GRCm39) C70G unknown Het
Gm28729 G A 9: 96,376,410 (GRCm39) T368M probably damaging Het
Gm4559 A G 7: 141,827,677 (GRCm39) C142R unknown Het
Golm1 T C 13: 59,792,920 (GRCm39) N195S probably benign Het
Hectd4 A T 5: 121,487,522 (GRCm39) S3506C possibly damaging Het
Hnrnpll G A 17: 80,351,943 (GRCm39) S334L possibly damaging Het
Ighv7-3 A T 12: 114,116,865 (GRCm39) I99N possibly damaging Het
Igkv8-24 A G 6: 70,194,002 (GRCm39) S69P not run Het
Ilvbl A T 10: 78,419,531 (GRCm39) H537L possibly damaging Het
Lama1 G A 17: 68,089,036 (GRCm39) G1569D Het
Lin7b A T 7: 45,018,649 (GRCm39) Y118* probably null Het
Mansc1 T A 6: 134,587,674 (GRCm39) S168C possibly damaging Het
Mast3 A G 8: 71,233,838 (GRCm39) V969A probably damaging Het
Muc4 C T 16: 32,754,500 (GRCm38) T1458I probably benign Het
Myh10 A G 11: 68,692,992 (GRCm39) E1429G probably damaging Het
Neurod1 G T 2: 79,284,689 (GRCm39) Y231* probably null Het
Nrxn2 G T 19: 6,581,540 (GRCm39) E1492* probably null Het
Nwd2 A G 5: 63,964,736 (GRCm39) Q1440R probably benign Het
Or10j3b A G 1: 173,043,538 (GRCm39) T107A probably benign Het
Or6z7 T A 7: 6,483,330 (GRCm39) N275I probably damaging Het
Or8u3-ps A G 2: 85,952,720 (GRCm39) Y151C probably damaging Het
Pacs1 T A 19: 5,195,148 (GRCm39) T479S probably benign Het
Pds5b A G 5: 150,701,726 (GRCm39) K786E probably damaging Het
Pigp A G 16: 94,171,264 (GRCm39) L9P probably benign Het
Plec C T 15: 76,071,946 (GRCm39) R707Q unknown Het
Ppef2 T A 5: 92,400,993 (GRCm39) H9L possibly damaging Het
Ppid T A 3: 79,507,698 (GRCm39) C296S probably damaging Het
Ppp2r5b T G 19: 6,278,514 (GRCm39) E465A possibly damaging Het
Ppp4r4 A G 12: 103,562,708 (GRCm39) N559S probably damaging Het
Rbpms A G 8: 34,356,416 (GRCm39) V28A probably damaging Het
Retreg2 A G 1: 75,121,332 (GRCm39) M203V probably damaging Het
Rfx4 A G 10: 84,699,213 (GRCm39) E367G probably damaging Het
Robo1 C T 16: 72,767,069 (GRCm39) P414S probably damaging Het
Sac3d1 T A 19: 6,166,178 (GRCm39) E410D probably damaging Het
Scgb2b19 A T 7: 32,979,211 (GRCm39) C24S possibly damaging Het
She T C 3: 89,738,919 (GRCm39) F37L probably damaging Het
Slc5a2 G A 7: 127,864,977 (GRCm39) V37I probably damaging Het
Smyd4 T A 11: 75,281,032 (GRCm39) D168E probably benign Het
Ssc5d C A 7: 4,931,572 (GRCm39) P260T probably damaging Het
Steap2 A G 5: 5,727,406 (GRCm39) F310L probably benign Het
Tctn1 A T 5: 122,386,071 (GRCm39) I347N probably damaging Het
Tmtc2 A G 10: 105,206,482 (GRCm39) L271P probably damaging Het
Tns3 T A 11: 8,491,192 (GRCm39) M122L possibly damaging Het
Ubr7 T G 12: 102,735,398 (GRCm39) C286G probably damaging Het
Usp16 T C 16: 87,276,188 (GRCm39) S509P probably benign Het
Usp44 A G 10: 93,682,290 (GRCm39) T247A probably damaging Het
Vmn2r92 A C 17: 18,387,621 (GRCm39) M209L probably benign Het
Zc3h6 C T 2: 128,856,473 (GRCm39) P518S probably damaging Het
Zfp229 A G 17: 21,964,280 (GRCm39) H170R probably damaging Het
Zfp960 A G 17: 17,308,227 (GRCm39) T314A probably benign Het
Other mutations in Ptprt
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00231:Ptprt APN 2 161,652,544 (GRCm39) missense probably benign 0.00
IGL00565:Ptprt APN 2 161,402,111 (GRCm39) missense probably damaging 1.00
IGL00925:Ptprt APN 2 161,498,083 (GRCm39) missense possibly damaging 0.52
IGL01344:Ptprt APN 2 161,393,737 (GRCm39) missense probably damaging 1.00
IGL01432:Ptprt APN 2 162,109,999 (GRCm39) splice site probably benign
IGL02008:Ptprt APN 2 161,769,593 (GRCm39) missense probably benign 0.02
IGL02040:Ptprt APN 2 162,079,992 (GRCm39) missense probably damaging 1.00
IGL02172:Ptprt APN 2 161,397,422 (GRCm39) missense probably damaging 1.00
IGL02231:Ptprt APN 2 162,119,966 (GRCm39) critical splice donor site probably null
IGL02231:Ptprt APN 2 162,079,980 (GRCm39) missense probably damaging 1.00
IGL02232:Ptprt APN 2 161,372,437 (GRCm39) missense probably damaging 0.96
IGL02277:Ptprt APN 2 161,389,301 (GRCm39) missense probably damaging 1.00
IGL02447:Ptprt APN 2 162,120,027 (GRCm39) missense probably benign 0.01
IGL02601:Ptprt APN 2 161,608,227 (GRCm39) missense probably benign 0.10
IGL02623:Ptprt APN 2 161,449,372 (GRCm39) splice site probably benign
IGL03379:Ptprt APN 2 161,397,379 (GRCm39) nonsense probably null
Poverina UTSW 2 161,743,417 (GRCm39) missense possibly damaging 0.70
IGL03055:Ptprt UTSW 2 161,375,533 (GRCm39) missense probably damaging 0.96
R0064:Ptprt UTSW 2 161,769,711 (GRCm39) splice site probably benign
R0129:Ptprt UTSW 2 162,119,990 (GRCm39) missense probably benign 0.35
R0131:Ptprt UTSW 2 162,120,030 (GRCm39) missense probably benign 0.00
R0131:Ptprt UTSW 2 162,120,030 (GRCm39) missense probably benign 0.00
R0132:Ptprt UTSW 2 162,120,030 (GRCm39) missense probably benign 0.00
R0316:Ptprt UTSW 2 161,449,239 (GRCm39) missense probably damaging 1.00
R0454:Ptprt UTSW 2 161,395,742 (GRCm39) missense probably damaging 0.96
R0488:Ptprt UTSW 2 161,395,745 (GRCm39) missense probably damaging 0.99
R0573:Ptprt UTSW 2 161,393,668 (GRCm39) missense probably damaging 1.00
R0614:Ptprt UTSW 2 161,654,040 (GRCm39) missense possibly damaging 0.59
R0834:Ptprt UTSW 2 161,654,059 (GRCm39) splice site probably null
R1023:Ptprt UTSW 2 161,400,863 (GRCm39) missense probably damaging 1.00
R1184:Ptprt UTSW 2 161,769,692 (GRCm39) missense possibly damaging 0.82
R1253:Ptprt UTSW 2 162,120,146 (GRCm39) missense probably damaging 1.00
R1476:Ptprt UTSW 2 161,769,404 (GRCm39) missense probably damaging 1.00
R1515:Ptprt UTSW 2 162,079,954 (GRCm39) missense probably damaging 1.00
R1595:Ptprt UTSW 2 161,652,469 (GRCm39) critical splice donor site probably null
R1939:Ptprt UTSW 2 161,769,560 (GRCm39) missense probably benign 0.45
R1987:Ptprt UTSW 2 161,608,241 (GRCm39) missense possibly damaging 0.48
R1987:Ptprt UTSW 2 161,400,818 (GRCm39) missense probably damaging 1.00
R2049:Ptprt UTSW 2 161,376,465 (GRCm39) missense probably damaging 1.00
R2140:Ptprt UTSW 2 161,653,908 (GRCm39) missense probably damaging 1.00
R2421:Ptprt UTSW 2 162,119,960 (GRCm39) splice site probably benign
R3432:Ptprt UTSW 2 161,769,449 (GRCm39) missense probably damaging 1.00
R3619:Ptprt UTSW 2 161,408,077 (GRCm39) missense probably damaging 1.00
R3757:Ptprt UTSW 2 161,653,950 (GRCm39) missense probably damaging 1.00
R3758:Ptprt UTSW 2 161,653,950 (GRCm39) missense probably damaging 1.00
R3834:Ptprt UTSW 2 161,389,307 (GRCm39) missense probably damaging 1.00
R3835:Ptprt UTSW 2 161,389,307 (GRCm39) missense probably damaging 1.00
R3915:Ptprt UTSW 2 161,397,475 (GRCm39) splice site probably benign
R4003:Ptprt UTSW 2 161,408,037 (GRCm39) splice site probably benign
R4387:Ptprt UTSW 2 161,769,570 (GRCm39) missense probably damaging 1.00
R4519:Ptprt UTSW 2 161,406,609 (GRCm39) missense probably damaging 1.00
R4618:Ptprt UTSW 2 161,395,765 (GRCm39) missense probably damaging 1.00
R4677:Ptprt UTSW 2 161,743,366 (GRCm39) critical splice donor site probably null
R4866:Ptprt UTSW 2 161,402,159 (GRCm39) missense probably damaging 1.00
R5088:Ptprt UTSW 2 162,080,095 (GRCm39) missense probably benign 0.01
R5173:Ptprt UTSW 2 161,769,676 (GRCm39) missense probably benign 0.01
R5215:Ptprt UTSW 2 162,120,084 (GRCm39) missense probably damaging 1.00
R5383:Ptprt UTSW 2 161,539,969 (GRCm39) missense probably damaging 1.00
R5398:Ptprt UTSW 2 161,769,512 (GRCm39) missense probably damaging 1.00
R5518:Ptprt UTSW 2 162,120,143 (GRCm39) missense probably damaging 0.99
R5711:Ptprt UTSW 2 161,652,524 (GRCm39) missense probably damaging 0.98
R5735:Ptprt UTSW 2 161,376,484 (GRCm39) missense probably damaging 0.98
R5834:Ptprt UTSW 2 161,402,189 (GRCm39) missense probably damaging 1.00
R5872:Ptprt UTSW 2 161,977,138 (GRCm39) missense probably damaging 1.00
R5926:Ptprt UTSW 2 161,406,606 (GRCm39) missense probably benign 0.00
R6210:Ptprt UTSW 2 162,109,949 (GRCm39) missense probably damaging 1.00
R6285:Ptprt UTSW 2 161,743,417 (GRCm39) missense possibly damaging 0.70
R6298:Ptprt UTSW 2 161,395,779 (GRCm39) missense probably damaging 1.00
R6406:Ptprt UTSW 2 161,395,703 (GRCm39) missense probably damaging 0.98
R6499:Ptprt UTSW 2 161,376,507 (GRCm39) missense probably benign 0.32
R6613:Ptprt UTSW 2 161,372,367 (GRCm39) missense probably damaging 1.00
R6622:Ptprt UTSW 2 161,395,760 (GRCm39) missense probably damaging 1.00
R7218:Ptprt UTSW 2 161,389,284 (GRCm39) missense probably damaging 1.00
R7247:Ptprt UTSW 2 161,375,443 (GRCm39) missense probably benign 0.15
R7733:Ptprt UTSW 2 161,417,707 (GRCm39) missense probably damaging 1.00
R7735:Ptprt UTSW 2 161,417,661 (GRCm39) missense probably damaging 1.00
R7813:Ptprt UTSW 2 161,372,413 (GRCm39) missense probably damaging 1.00
R8031:Ptprt UTSW 2 161,977,377 (GRCm39) missense probably damaging 1.00
R8074:Ptprt UTSW 2 161,769,581 (GRCm39) missense possibly damaging 0.77
R8151:Ptprt UTSW 2 162,120,005 (GRCm39) missense probably damaging 1.00
R8236:Ptprt UTSW 2 161,528,988 (GRCm39) critical splice donor site probably null
R8308:Ptprt UTSW 2 161,769,566 (GRCm39) missense probably benign 0.00
R8348:Ptprt UTSW 2 161,400,806 (GRCm39) missense probably damaging 1.00
R8362:Ptprt UTSW 2 161,393,667 (GRCm39) missense probably damaging 1.00
R8365:Ptprt UTSW 2 161,743,451 (GRCm39) missense probably benign 0.05
R8448:Ptprt UTSW 2 161,400,806 (GRCm39) missense probably damaging 1.00
R8512:Ptprt UTSW 2 161,400,783 (GRCm39) missense probably benign 0.00
R8715:Ptprt UTSW 2 161,372,463 (GRCm39) missense probably damaging 1.00
R9004:Ptprt UTSW 2 161,608,314 (GRCm39) missense probably benign 0.04
R9046:Ptprt UTSW 2 161,372,361 (GRCm39) missense possibly damaging 0.58
R9222:Ptprt UTSW 2 161,402,106 (GRCm39) missense probably damaging 1.00
R9297:Ptprt UTSW 2 161,417,698 (GRCm39) missense probably benign
R9318:Ptprt UTSW 2 161,417,698 (GRCm39) missense probably benign
R9476:Ptprt UTSW 2 161,397,381 (GRCm39) missense probably damaging 1.00
R9510:Ptprt UTSW 2 161,397,381 (GRCm39) missense probably damaging 1.00
R9571:Ptprt UTSW 2 161,395,732 (GRCm39) missense probably benign 0.10
X0064:Ptprt UTSW 2 161,769,403 (GRCm39) missense probably damaging 1.00
Z1088:Ptprt UTSW 2 162,080,041 (GRCm39) missense possibly damaging 0.86
Z1177:Ptprt UTSW 2 162,204,868 (GRCm39) missense possibly damaging 0.77
Z1177:Ptprt UTSW 2 161,574,807 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGGGCATTTCCACTATGC -3'
(R):5'- ACTTTTCTGACCAGTGGAGTGC -3'

Sequencing Primer
(F):5'- GGCATTTCCACTATGCTCTCAAG -3'
(R):5'- AACTCCTGAAGTGATAGTTTCTCCTG -3'
Posted On 2019-10-24