Incidental Mutation 'R7576:Ptprt'
ID586400
Institutional Source Beutler Lab
Gene Symbol Ptprt
Ensembl Gene ENSMUSG00000053141
Gene Nameprotein tyrosine phosphatase, receptor type, T
SynonymsRPTPrho
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.125) question?
Stock #R7576 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location161521990-162661147 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 161607305 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 873 (T873A)
Ref Sequence ENSEMBL: ENSMUSP00000105067 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000109441] [ENSMUST00000109442] [ENSMUST00000109443] [ENSMUST00000109445]
Predicted Effect possibly damaging
Transcript: ENSMUST00000109441
AA Change: T873A

PolyPhen 2 Score 0.883 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000105067
Gene: ENSMUSG00000053141
AA Change: T873A

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
MAM 31 195 2.21e-71 SMART
IG 202 290 3.94e-2 SMART
FN3 292 375 3.35e-3 SMART
FN3 388 477 4.06e-2 SMART
FN3 489 579 1.2e-4 SMART
transmembrane domain 753 772 N/A INTRINSIC
PTPc 882 1159 3.64e-129 SMART
PTPc 1188 1453 4.24e-98 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000109442
AA Change: T892A

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000105068
Gene: ENSMUSG00000053141
AA Change: T892A

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
MAM 31 195 2.21e-71 SMART
IG 202 290 3.94e-2 SMART
FN3 292 375 3.35e-3 SMART
FN3 388 477 4.06e-2 SMART
FN3 489 579 1.2e-4 SMART
low complexity region 738 749 N/A INTRINSIC
transmembrane domain 772 791 N/A INTRINSIC
PTPc 901 1158 5.56e-134 SMART
PTPc 1187 1452 4.24e-98 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000109443
AA Change: T883A

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000105069
Gene: ENSMUSG00000053141
AA Change: T883A

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
MAM 31 195 2.21e-71 SMART
IG 202 290 3.94e-2 SMART
FN3 292 375 3.35e-3 SMART
FN3 388 477 4.06e-2 SMART
FN3 489 579 1.2e-4 SMART
low complexity region 778 792 N/A INTRINSIC
PTPc 892 1149 5.56e-134 SMART
PTPc 1178 1443 4.24e-98 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000109445
AA Change: T873A

PolyPhen 2 Score 0.891 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000105071
Gene: ENSMUSG00000053141
AA Change: T873A

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
MAM 31 195 2.21e-71 SMART
IG 202 290 3.94e-2 SMART
FN3 292 375 3.35e-3 SMART
FN3 388 477 4.06e-2 SMART
FN3 489 579 1.2e-4 SMART
transmembrane domain 753 772 N/A INTRINSIC
PTPc 882 1139 5.56e-134 SMART
PTPc 1168 1433 4.24e-98 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitotic cycle, and oncogenic transformation. This PTP possesses an extracellular region, a single transmembrane region, and two tandem intracellular catalytic domains, and thus represents a receptor-type PTP. The extracellular region contains a meprin-A5 antigen-PTP (MAM) domain, Ig-like and fibronectin type III-like repeats. The protein domain structure and the expression pattern of the mouse counterpart of this PTP suggest its roles in both signal transduction and cellular adhesion in the central nervous system. Two alternatively spliced transcript variants of this gene, which encode distinct proteins, have been reported. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele are highly susceptible to carcinogen azoxymethane-induced colon tumors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ahdc1 A T 4: 133,065,002 S1185C possibly damaging Het
Akap9 C G 5: 3,968,745 H1109D probably benign Het
Alpk2 T C 18: 65,306,816 D502G possibly damaging Het
Bcl2 A G 1: 106,712,423 V153A possibly damaging Het
Brinp3 A T 1: 146,901,563 S583C probably damaging Het
Calr4 A T 4: 109,238,964 Q113L probably benign Het
Carm1 T G 9: 21,586,536 probably null Het
Ccdc30 A G 4: 119,349,866 L353P probably damaging Het
Ccdc91 C G 6: 147,590,459 Q280E unknown Het
Cdk5rap2 T C 4: 70,266,872 T1114A probably benign Het
Enpep T A 3: 129,284,091 T626S probably benign Het
Epcam T C 17: 87,640,293 S64P probably damaging Het
Erc1 G T 6: 119,824,760 P99T possibly damaging Het
Fastkd1 A G 2: 69,694,644 L636S probably damaging Het
Fmn1 A G 2: 113,365,008 D351G unknown Het
Fndc8 T G 11: 82,897,574 S77A probably damaging Het
Gbp10 G A 5: 105,236,149 probably benign Het
Gemin6 T A 17: 80,225,726 Y29* probably null Het
Gja8 T C 3: 96,919,893 E151G probably benign Het
Gje1 A G 10: 14,716,757 Y94H probably damaging Het
Glt6d1 A G 2: 25,814,122 F26S probably benign Het
Gltpd2 T A 11: 70,519,480 probably null Het
Gm10153 A C 7: 142,190,122 C70G unknown Het
Gm28729 G A 9: 96,494,357 T368M probably damaging Het
Gm4559 A G 7: 142,273,940 C142R unknown Het
Golm1 T C 13: 59,645,106 N195S probably benign Het
Hectd4 A T 5: 121,349,459 S3506C possibly damaging Het
Hnrnpll G A 17: 80,044,514 S334L possibly damaging Het
Ighv7-3 A T 12: 114,153,245 I99N possibly damaging Het
Igkv8-24 A G 6: 70,217,018 S69P not run Het
Ilvbl A T 10: 78,583,697 H537L possibly damaging Het
Lama1 G A 17: 67,782,041 G1569D Het
Lin7b A T 7: 45,369,225 Y118* probably null Het
Mansc1 T A 6: 134,610,711 S168C possibly damaging Het
Mast3 A G 8: 70,781,194 V969A probably damaging Het
Muc4 C T 16: 32,754,500 T1458I probably benign Het
Myh10 A G 11: 68,802,166 E1429G probably damaging Het
Narfl A C 17: 25,778,970 T154P probably damaging Het
Neurod1 G T 2: 79,454,345 Y231* probably null Het
Nrxn2 G T 19: 6,531,510 E1492* probably null Het
Nwd2 A G 5: 63,807,393 Q1440R probably benign Het
Olfr1038-ps A G 2: 86,122,376 Y151C probably damaging Het
Olfr1404 A G 1: 173,215,971 T107A probably benign Het
Olfr5 T A 7: 6,480,331 N275I probably damaging Het
Pacs1 T A 19: 5,145,120 T479S probably benign Het
Pds5b A G 5: 150,778,261 K786E probably damaging Het
Pigp A G 16: 94,370,405 L9P probably benign Het
Plec C T 15: 76,187,746 R707Q unknown Het
Ppef2 T A 5: 92,253,134 H9L possibly damaging Het
Ppid T A 3: 79,600,391 C296S probably damaging Het
Ppp2r5b T G 19: 6,228,484 E465A possibly damaging Het
Ppp4r4 A G 12: 103,596,449 N559S probably damaging Het
Rbpms A G 8: 33,866,388 V28A probably damaging Het
Retreg2 A G 1: 75,144,688 M203V probably damaging Het
Rfx4 A G 10: 84,863,349 E367G probably damaging Het
Robo1 C T 16: 72,970,181 P414S probably damaging Het
Sac3d1 T A 19: 6,116,148 E410D probably damaging Het
Scgb2b19 A T 7: 33,279,786 C24S possibly damaging Het
She T C 3: 89,831,612 F37L probably damaging Het
Slc5a2 G A 7: 128,265,805 V37I probably damaging Het
Smyd4 T A 11: 75,390,206 D168E probably benign Het
Ssc5d C A 7: 4,928,573 P260T probably damaging Het
Steap2 A G 5: 5,677,406 F310L probably benign Het
Tctn1 A T 5: 122,248,008 I347N probably damaging Het
Tmtc2 A G 10: 105,370,621 L271P probably damaging Het
Tns3 T A 11: 8,541,192 M122L possibly damaging Het
Ubr7 T G 12: 102,769,139 C286G probably damaging Het
Usp16 T C 16: 87,479,300 S509P probably benign Het
Usp44 A G 10: 93,846,428 T247A probably damaging Het
Vmn2r92 A C 17: 18,167,359 M209L probably benign Het
Wdr34 C T 2: 30,048,778 R31Q probably benign Het
Zc3h6 C T 2: 129,014,553 P518S probably damaging Het
Zfp229 A G 17: 21,745,299 H170R probably damaging Het
Zfp960 A G 17: 17,087,965 T314A probably benign Het
Other mutations in Ptprt
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00231:Ptprt APN 2 161810624 missense probably benign 0.00
IGL00565:Ptprt APN 2 161560191 missense probably damaging 1.00
IGL00925:Ptprt APN 2 161656163 missense possibly damaging 0.52
IGL01344:Ptprt APN 2 161551817 missense probably damaging 1.00
IGL01432:Ptprt APN 2 162268079 splice site probably benign
IGL02008:Ptprt APN 2 161927673 missense probably benign 0.02
IGL02040:Ptprt APN 2 162238072 missense probably damaging 1.00
IGL02172:Ptprt APN 2 161555502 missense probably damaging 1.00
IGL02231:Ptprt APN 2 162238060 missense probably damaging 1.00
IGL02231:Ptprt APN 2 162278046 critical splice donor site probably null
IGL02232:Ptprt APN 2 161530517 missense probably damaging 0.96
IGL02277:Ptprt APN 2 161547381 missense probably damaging 1.00
IGL02447:Ptprt APN 2 162278107 missense probably benign 0.01
IGL02601:Ptprt APN 2 161766307 missense probably benign 0.10
IGL02623:Ptprt APN 2 161607452 splice site probably benign
IGL03379:Ptprt APN 2 161555459 nonsense probably null
Poverina UTSW 2 161901497 missense possibly damaging 0.70
IGL03055:Ptprt UTSW 2 161533613 missense probably damaging 0.96
R0064:Ptprt UTSW 2 161927791 splice site probably benign
R0129:Ptprt UTSW 2 162278070 missense probably benign 0.35
R0131:Ptprt UTSW 2 162278110 missense probably benign 0.00
R0131:Ptprt UTSW 2 162278110 missense probably benign 0.00
R0132:Ptprt UTSW 2 162278110 missense probably benign 0.00
R0316:Ptprt UTSW 2 161607319 missense probably damaging 1.00
R0454:Ptprt UTSW 2 161553822 missense probably damaging 0.96
R0488:Ptprt UTSW 2 161553825 missense probably damaging 0.99
R0573:Ptprt UTSW 2 161551748 missense probably damaging 1.00
R0614:Ptprt UTSW 2 161812120 missense possibly damaging 0.59
R0834:Ptprt UTSW 2 161812139 splice site probably null
R1023:Ptprt UTSW 2 161558943 missense probably damaging 1.00
R1184:Ptprt UTSW 2 161927772 missense possibly damaging 0.82
R1253:Ptprt UTSW 2 162278226 missense probably damaging 1.00
R1476:Ptprt UTSW 2 161927484 missense probably damaging 1.00
R1515:Ptprt UTSW 2 162238034 missense probably damaging 1.00
R1595:Ptprt UTSW 2 161810549 critical splice donor site probably null
R1939:Ptprt UTSW 2 161927640 missense probably benign 0.45
R1987:Ptprt UTSW 2 161558898 missense probably damaging 1.00
R1987:Ptprt UTSW 2 161766321 missense possibly damaging 0.48
R2049:Ptprt UTSW 2 161534545 missense probably damaging 1.00
R2140:Ptprt UTSW 2 161811988 missense probably damaging 1.00
R2421:Ptprt UTSW 2 162278040 splice site probably benign
R3432:Ptprt UTSW 2 161927529 missense probably damaging 1.00
R3619:Ptprt UTSW 2 161566157 missense probably damaging 1.00
R3757:Ptprt UTSW 2 161812030 missense probably damaging 1.00
R3758:Ptprt UTSW 2 161812030 missense probably damaging 1.00
R3834:Ptprt UTSW 2 161547387 missense probably damaging 1.00
R3835:Ptprt UTSW 2 161547387 missense probably damaging 1.00
R3915:Ptprt UTSW 2 161555555 splice site probably benign
R4003:Ptprt UTSW 2 161566117 splice site probably benign
R4387:Ptprt UTSW 2 161927650 missense probably damaging 1.00
R4519:Ptprt UTSW 2 161564689 missense probably damaging 1.00
R4618:Ptprt UTSW 2 161553845 missense probably damaging 1.00
R4677:Ptprt UTSW 2 161901446 critical splice donor site probably null
R4866:Ptprt UTSW 2 161560239 missense probably damaging 1.00
R5088:Ptprt UTSW 2 162238175 missense probably benign 0.01
R5173:Ptprt UTSW 2 161927756 missense probably benign 0.01
R5215:Ptprt UTSW 2 162278164 missense probably damaging 1.00
R5383:Ptprt UTSW 2 161698049 missense probably damaging 1.00
R5398:Ptprt UTSW 2 161927592 missense probably damaging 1.00
R5518:Ptprt UTSW 2 162278223 missense probably damaging 0.99
R5711:Ptprt UTSW 2 161810604 missense probably damaging 0.98
R5735:Ptprt UTSW 2 161534564 missense probably damaging 0.98
R5834:Ptprt UTSW 2 161560269 missense probably damaging 1.00
R5872:Ptprt UTSW 2 162135218 missense probably damaging 1.00
R5926:Ptprt UTSW 2 161564686 missense probably benign 0.00
R6210:Ptprt UTSW 2 162268029 missense probably damaging 1.00
R6285:Ptprt UTSW 2 161901497 missense possibly damaging 0.70
R6298:Ptprt UTSW 2 161553859 missense probably damaging 1.00
R6406:Ptprt UTSW 2 161553783 missense probably damaging 0.98
R6499:Ptprt UTSW 2 161534587 missense probably benign 0.32
R6613:Ptprt UTSW 2 161530447 missense probably damaging 1.00
R6622:Ptprt UTSW 2 161553840 missense probably damaging 1.00
R7218:Ptprt UTSW 2 161547364 missense probably damaging 1.00
R7247:Ptprt UTSW 2 161533523 missense probably benign 0.15
R7733:Ptprt UTSW 2 161575787 missense probably damaging 1.00
R7735:Ptprt UTSW 2 161575741 missense probably damaging 1.00
R7813:Ptprt UTSW 2 161530493 missense probably damaging 1.00
R8031:Ptprt UTSW 2 162135457 missense probably damaging 1.00
R8074:Ptprt UTSW 2 161927661 missense possibly damaging 0.77
X0064:Ptprt UTSW 2 161927483 missense probably damaging 1.00
Z1088:Ptprt UTSW 2 162238121 missense possibly damaging 0.86
Z1177:Ptprt UTSW 2 161732887 missense probably damaging 1.00
Z1177:Ptprt UTSW 2 162362948 missense possibly damaging 0.77
Predicted Primers PCR Primer
(F):5'- TGGGGCATTTCCACTATGC -3'
(R):5'- ACTTTTCTGACCAGTGGAGTGC -3'

Sequencing Primer
(F):5'- GGCATTTCCACTATGCTCTCAAG -3'
(R):5'- AACTCCTGAAGTGATAGTTTCTCCTG -3'
Posted On2019-10-24