Incidental Mutation 'R7576:Enpep'
ID586404
Institutional Source Beutler Lab
Gene Symbol Enpep
Ensembl Gene ENSMUSG00000028024
Gene Nameglutamyl aminopeptidase
SynonymsLy51, aminopeptidase-A, Bp-1/6C3, 6030431M22Rik, APA, Ly-51
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7576 (G1)
Quality Score225.009
Status Not validated
Chromosome3
Chromosomal Location129269175-129332720 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 129284091 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 626 (T626S)
Ref Sequence ENSEMBL: ENSMUSP00000029658 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029658]
Predicted Effect probably benign
Transcript: ENSMUST00000029658
AA Change: T626S

PolyPhen 2 Score 0.027 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000029658
Gene: ENSMUSG00000028024
AA Change: T626S

DomainStartEndE-ValueType
transmembrane domain 21 40 N/A INTRINSIC
Pfam:Peptidase_M1 84 474 6e-147 PFAM
Pfam:ERAP1_C 607 925 1e-64 PFAM
Predicted Effect
SMART Domains Protein: ENSMUSP00000129759
Gene: ENSMUSG00000028024
AA Change: T202S

DomainStartEndE-ValueType
Pfam:Peptidase_M1 1 51 1.5e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000170918
SMART Domains Protein: ENSMUSP00000128872
Gene: ENSMUSG00000028024

DomainStartEndE-ValueType
Pfam:Peptidase_M1 12 402 9.6e-148 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a targeted null mutation are viable, fertile and morphologically unaffected with normal B and T cell development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ahdc1 A T 4: 133,065,002 S1185C possibly damaging Het
Akap9 C G 5: 3,968,745 H1109D probably benign Het
Alpk2 T C 18: 65,306,816 D502G possibly damaging Het
Bcl2 A G 1: 106,712,423 V153A possibly damaging Het
Brinp3 A T 1: 146,901,563 S583C probably damaging Het
Calr4 A T 4: 109,238,964 Q113L probably benign Het
Carm1 T G 9: 21,586,536 probably null Het
Ccdc30 A G 4: 119,349,866 L353P probably damaging Het
Ccdc91 C G 6: 147,590,459 Q280E unknown Het
Cdk5rap2 T C 4: 70,266,872 T1114A probably benign Het
Epcam T C 17: 87,640,293 S64P probably damaging Het
Erc1 G T 6: 119,824,760 P99T possibly damaging Het
Fastkd1 A G 2: 69,694,644 L636S probably damaging Het
Fmn1 A G 2: 113,365,008 D351G unknown Het
Fndc8 T G 11: 82,897,574 S77A probably damaging Het
Gbp10 G A 5: 105,236,149 probably benign Het
Gemin6 T A 17: 80,225,726 Y29* probably null Het
Gja8 T C 3: 96,919,893 E151G probably benign Het
Gje1 A G 10: 14,716,757 Y94H probably damaging Het
Glt6d1 A G 2: 25,814,122 F26S probably benign Het
Gltpd2 T A 11: 70,519,480 probably null Het
Gm10153 A C 7: 142,190,122 C70G unknown Het
Gm28729 G A 9: 96,494,357 T368M probably damaging Het
Gm4559 A G 7: 142,273,940 C142R unknown Het
Golm1 T C 13: 59,645,106 N195S probably benign Het
Hectd4 A T 5: 121,349,459 S3506C possibly damaging Het
Hnrnpll G A 17: 80,044,514 S334L possibly damaging Het
Ighv7-3 A T 12: 114,153,245 I99N possibly damaging Het
Igkv8-24 A G 6: 70,217,018 S69P not run Het
Ilvbl A T 10: 78,583,697 H537L possibly damaging Het
Lama1 G A 17: 67,782,041 G1569D Het
Lin7b A T 7: 45,369,225 Y118* probably null Het
Mansc1 T A 6: 134,610,711 S168C possibly damaging Het
Mast3 A G 8: 70,781,194 V969A probably damaging Het
Muc4 C T 16: 32,754,500 T1458I probably benign Het
Myh10 A G 11: 68,802,166 E1429G probably damaging Het
Narfl A C 17: 25,778,970 T154P probably damaging Het
Neurod1 G T 2: 79,454,345 Y231* probably null Het
Nrxn2 G T 19: 6,531,510 E1492* probably null Het
Nwd2 A G 5: 63,807,393 Q1440R probably benign Het
Olfr1038-ps A G 2: 86,122,376 Y151C probably damaging Het
Olfr1404 A G 1: 173,215,971 T107A probably benign Het
Olfr5 T A 7: 6,480,331 N275I probably damaging Het
Pacs1 T A 19: 5,145,120 T479S probably benign Het
Pds5b A G 5: 150,778,261 K786E probably damaging Het
Pigp A G 16: 94,370,405 L9P probably benign Het
Plec C T 15: 76,187,746 R707Q unknown Het
Ppef2 T A 5: 92,253,134 H9L possibly damaging Het
Ppid T A 3: 79,600,391 C296S probably damaging Het
Ppp2r5b T G 19: 6,228,484 E465A possibly damaging Het
Ppp4r4 A G 12: 103,596,449 N559S probably damaging Het
Ptprt T C 2: 161,607,305 T873A possibly damaging Het
Rbpms A G 8: 33,866,388 V28A probably damaging Het
Retreg2 A G 1: 75,144,688 M203V probably damaging Het
Rfx4 A G 10: 84,863,349 E367G probably damaging Het
Robo1 C T 16: 72,970,181 P414S probably damaging Het
Sac3d1 T A 19: 6,116,148 E410D probably damaging Het
Scgb2b19 A T 7: 33,279,786 C24S possibly damaging Het
She T C 3: 89,831,612 F37L probably damaging Het
Slc5a2 G A 7: 128,265,805 V37I probably damaging Het
Smyd4 T A 11: 75,390,206 D168E probably benign Het
Ssc5d C A 7: 4,928,573 P260T probably damaging Het
Steap2 A G 5: 5,677,406 F310L probably benign Het
Tctn1 A T 5: 122,248,008 I347N probably damaging Het
Tmtc2 A G 10: 105,370,621 L271P probably damaging Het
Tns3 T A 11: 8,541,192 M122L possibly damaging Het
Ubr7 T G 12: 102,769,139 C286G probably damaging Het
Usp16 T C 16: 87,479,300 S509P probably benign Het
Usp44 A G 10: 93,846,428 T247A probably damaging Het
Vmn2r92 A C 17: 18,167,359 M209L probably benign Het
Wdr34 C T 2: 30,048,778 R31Q probably benign Het
Zc3h6 C T 2: 129,014,553 P518S probably damaging Het
Zfp229 A G 17: 21,745,299 H170R probably damaging Het
Zfp960 A G 17: 17,087,965 T314A probably benign Het
Other mutations in Enpep
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00791:Enpep APN 3 129332082 missense possibly damaging 0.69
IGL01895:Enpep APN 3 129270334 missense possibly damaging 0.89
IGL02193:Enpep APN 3 129281687 missense possibly damaging 0.46
IGL02215:Enpep APN 3 129270277 splice site probably benign
IGL02511:Enpep APN 3 129321410 missense probably damaging 1.00
IGL02579:Enpep APN 3 129284090 missense probably benign 0.07
IGL02634:Enpep APN 3 129309857 missense probably damaging 1.00
IGL03034:Enpep APN 3 129298950 missense probably damaging 0.99
IGL03214:Enpep APN 3 129293247 missense probably benign
IGL03401:Enpep APN 3 129312620 missense probably benign 0.01
P0041:Enpep UTSW 3 129332198 missense possibly damaging 0.80
R0371:Enpep UTSW 3 129283867 critical splice donor site probably null
R0479:Enpep UTSW 3 129312674 missense possibly damaging 0.65
R1036:Enpep UTSW 3 129284109 missense probably damaging 0.99
R1466:Enpep UTSW 3 129319448 missense probably damaging 1.00
R1466:Enpep UTSW 3 129319448 missense probably damaging 1.00
R1584:Enpep UTSW 3 129319448 missense probably damaging 1.00
R2060:Enpep UTSW 3 129280523 missense probably benign 0.14
R2101:Enpep UTSW 3 129298938 missense probably benign 0.00
R2153:Enpep UTSW 3 129280582 missense probably damaging 0.99
R2474:Enpep UTSW 3 129284158 missense possibly damaging 0.77
R3618:Enpep UTSW 3 129284158 missense possibly damaging 0.77
R3619:Enpep UTSW 3 129284158 missense possibly damaging 0.77
R4275:Enpep UTSW 3 129332278 missense probably benign 0.02
R4291:Enpep UTSW 3 129270317 nonsense probably null
R4438:Enpep UTSW 3 129284091 missense possibly damaging 0.94
R4570:Enpep UTSW 3 129281548 missense possibly damaging 0.67
R4678:Enpep UTSW 3 129303713 critical splice donor site probably null
R4679:Enpep UTSW 3 129303713 critical splice donor site probably null
R4748:Enpep UTSW 3 129332163 missense probably damaging 1.00
R4878:Enpep UTSW 3 129276771 missense probably benign 0.17
R4954:Enpep UTSW 3 129284180 missense probably damaging 0.98
R5074:Enpep UTSW 3 129303755 missense probably damaging 1.00
R5261:Enpep UTSW 3 129305426 missense probably damaging 1.00
R5328:Enpep UTSW 3 129280510 missense probably benign 0.30
R5661:Enpep UTSW 3 129276757 missense probably damaging 0.98
R5687:Enpep UTSW 3 129299094 splice site probably null
R5695:Enpep UTSW 3 129309099 missense probably damaging 1.00
R5697:Enpep UTSW 3 129309123 missense probably benign
R5889:Enpep UTSW 3 129312578 missense probably damaging 1.00
R5940:Enpep UTSW 3 129312578 missense probably damaging 1.00
R5968:Enpep UTSW 3 129280938 missense probably benign
R5976:Enpep UTSW 3 129299124 missense probably damaging 0.97
R6151:Enpep UTSW 3 129332418 missense possibly damaging 0.82
R6367:Enpep UTSW 3 129332081 missense possibly damaging 0.94
R6468:Enpep UTSW 3 129331860 critical splice donor site probably null
R6484:Enpep UTSW 3 129321481 missense probably damaging 0.96
R6938:Enpep UTSW 3 129298950 missense probably damaging 0.99
R6989:Enpep UTSW 3 129280950 missense probably damaging 1.00
R7073:Enpep UTSW 3 129312670 nonsense probably null
R7258:Enpep UTSW 3 129332075 missense probably benign 0.01
R7452:Enpep UTSW 3 129271403 missense possibly damaging 0.81
R7684:Enpep UTSW 3 129321445 missense probably damaging 1.00
R7697:Enpep UTSW 3 129309101 missense probably damaging 1.00
R8050:Enpep UTSW 3 129305516 missense probably damaging 1.00
R8080:Enpep UTSW 3 129299134 missense probably damaging 1.00
R8318:Enpep UTSW 3 129270337 missense probably damaging 1.00
R8423:Enpep UTSW 3 129309125 missense probably damaging 1.00
R8474:Enpep UTSW 3 129319427 missense probably damaging 1.00
R8532:Enpep UTSW 3 129276653 nonsense probably null
R8826:Enpep UTSW 3 129271418 missense probably damaging 0.97
Z1177:Enpep UTSW 3 129276680 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCAGCAGCGGAGAATCTCTG -3'
(R):5'- GTCTAAATCAAACTTGACTCTGTGAGC -3'

Sequencing Primer
(F):5'- TCTCTGGAAGAAGAAACAGGGAC -3'
(R):5'- CTTGACTCTGTGAGCTAATATTGC -3'
Posted On2019-10-24