Incidental Mutation 'R7576:Erc1'
ID586418
Institutional Source Beutler Lab
Gene Symbol Erc1
Ensembl Gene ENSMUSG00000030172
Gene NameELKS/RAB6-interacting/CAST family member 1
SynonymsB430107L16Rik, Rab6ip2, 5033405M01Rik, RAB6IP2A, 9630025C19Rik, RAB6IP2B
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7576 (G1)
Quality Score225.009
Status Not validated
Chromosome6
Chromosomal Location119570796-119848167 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 119824760 bp
ZygosityHeterozygous
Amino Acid Change Proline to Threonine at position 99 (P99T)
Ref Sequence ENSEMBL: ENSMUSP00000032279 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032279] [ENSMUST00000079582] [ENSMUST00000183703] [ENSMUST00000183880] [ENSMUST00000183911] [ENSMUST00000184838] [ENSMUST00000184864] [ENSMUST00000185139] [ENSMUST00000185143]
Predicted Effect possibly damaging
Transcript: ENSMUST00000032279
AA Change: P99T

PolyPhen 2 Score 0.930 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000032279
Gene: ENSMUSG00000030172
AA Change: P99T

DomainStartEndE-ValueType
low complexity region 13 34 N/A INTRINSIC
low complexity region 35 51 N/A INTRINSIC
Pfam:Cast 154 466 1.8e-142 PFAM
Pfam:Cast 453 838 3.5e-163 PFAM
Pfam:Cast 833 986 8e-61 PFAM
Pfam:RBD-FIP 1072 1112 1.5e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000079582
SMART Domains Protein: ENSMUSP00000078534
Gene: ENSMUSG00000030172

DomainStartEndE-ValueType
Pfam:Cast 3 349 8.9e-149 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000183703
AA Change: P99T

PolyPhen 2 Score 0.930 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000139031
Gene: ENSMUSG00000030172
AA Change: P99T

DomainStartEndE-ValueType
low complexity region 13 34 N/A INTRINSIC
low complexity region 35 51 N/A INTRINSIC
Pfam:Cast 154 986 6.9e-291 PFAM
Pfam:RBD-FIP 1072 1112 1.5e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000183880
AA Change: P99T

PolyPhen 2 Score 0.028 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000138823
Gene: ENSMUSG00000030172
AA Change: P99T

DomainStartEndE-ValueType
low complexity region 13 34 N/A INTRINSIC
low complexity region 35 51 N/A INTRINSIC
Pfam:Cast 154 914 4.3e-296 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000183911
AA Change: P99T

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000139118
Gene: ENSMUSG00000030172
AA Change: P99T

DomainStartEndE-ValueType
low complexity region 13 34 N/A INTRINSIC
low complexity region 35 51 N/A INTRINSIC
Pfam:Cast 154 954 4.2e-293 PFAM
Pfam:RBD-FIP 1040 1080 8.5e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000184838
AA Change: P99T

PolyPhen 2 Score 0.084 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000139030
Gene: ENSMUSG00000030172
AA Change: P99T

DomainStartEndE-ValueType
low complexity region 13 34 N/A INTRINSIC
low complexity region 35 51 N/A INTRINSIC
Pfam:Cast 154 942 3.5e-291 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000184864
AA Change: P99T

PolyPhen 2 Score 0.084 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000139256
Gene: ENSMUSG00000030172
AA Change: P99T

DomainStartEndE-ValueType
low complexity region 13 34 N/A INTRINSIC
low complexity region 35 51 N/A INTRINSIC
Pfam:Cast 154 982 2e-288 PFAM
Pfam:RBD-FIP 1068 1108 8.7e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000185139
AA Change: P99T

PolyPhen 2 Score 0.023 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000139152
Gene: ENSMUSG00000030172
AA Change: P99T

DomainStartEndE-ValueType
low complexity region 13 34 N/A INTRINSIC
low complexity region 35 51 N/A INTRINSIC
Pfam:Cast 154 958 3.6e-295 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000185143
AA Change: P99T
SMART Domains Protein: ENSMUSP00000138989
Gene: ENSMUSG00000030172
AA Change: P99T

DomainStartEndE-ValueType
low complexity region 13 34 N/A INTRINSIC
low complexity region 35 51 N/A INTRINSIC
Pfam:Cast 154 224 1.7e-28 PFAM
Pfam:Cast 222 686 8e-145 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of a family of RIM-binding proteins. RIMs are active zone proteins that regulate neurotransmitter release. This gene has been found fused to the receptor-type tyrosine kinase gene RET by gene rearrangement due to the translocation t(10;12)(q11;p13) in thyroid papillary carcinoma. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2014]
PHENOTYPE: Mice homozygous for null mutations in this gene display embryonic lethality. Mice heterozygous for a gene trap null allele exhibit increased sensitivity to ionizing radiation-induced lethality, with males being more affected than females. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ahdc1 A T 4: 133,065,002 S1185C possibly damaging Het
Akap9 C G 5: 3,968,745 H1109D probably benign Het
Alpk2 T C 18: 65,306,816 D502G possibly damaging Het
Bcl2 A G 1: 106,712,423 V153A possibly damaging Het
Brinp3 A T 1: 146,901,563 S583C probably damaging Het
Calr4 A T 4: 109,238,964 Q113L probably benign Het
Carm1 T G 9: 21,586,536 probably null Het
Ccdc30 A G 4: 119,349,866 L353P probably damaging Het
Ccdc91 C G 6: 147,590,459 Q280E unknown Het
Cdk5rap2 T C 4: 70,266,872 T1114A probably benign Het
Enpep T A 3: 129,284,091 T626S probably benign Het
Epcam T C 17: 87,640,293 S64P probably damaging Het
Fastkd1 A G 2: 69,694,644 L636S probably damaging Het
Fmn1 A G 2: 113,365,008 D351G unknown Het
Fndc8 T G 11: 82,897,574 S77A probably damaging Het
Gbp10 G A 5: 105,236,149 probably benign Het
Gemin6 T A 17: 80,225,726 Y29* probably null Het
Gja8 T C 3: 96,919,893 E151G probably benign Het
Gje1 A G 10: 14,716,757 Y94H probably damaging Het
Glt6d1 A G 2: 25,814,122 F26S probably benign Het
Gltpd2 T A 11: 70,519,480 probably null Het
Gm10153 A C 7: 142,190,122 C70G unknown Het
Gm28729 G A 9: 96,494,357 T368M probably damaging Het
Gm4559 A G 7: 142,273,940 C142R unknown Het
Golm1 T C 13: 59,645,106 N195S probably benign Het
Hectd4 A T 5: 121,349,459 S3506C possibly damaging Het
Hnrnpll G A 17: 80,044,514 S334L possibly damaging Het
Ighv7-3 A T 12: 114,153,245 I99N possibly damaging Het
Igkv8-24 A G 6: 70,217,018 S69P not run Het
Ilvbl A T 10: 78,583,697 H537L possibly damaging Het
Lama1 G A 17: 67,782,041 G1569D Het
Lin7b A T 7: 45,369,225 Y118* probably null Het
Mansc1 T A 6: 134,610,711 S168C possibly damaging Het
Mast3 A G 8: 70,781,194 V969A probably damaging Het
Muc4 C T 16: 32,754,500 T1458I probably benign Het
Myh10 A G 11: 68,802,166 E1429G probably damaging Het
Narfl A C 17: 25,778,970 T154P probably damaging Het
Neurod1 G T 2: 79,454,345 Y231* probably null Het
Nrxn2 G T 19: 6,531,510 E1492* probably null Het
Nwd2 A G 5: 63,807,393 Q1440R probably benign Het
Olfr1038-ps A G 2: 86,122,376 Y151C probably damaging Het
Olfr1404 A G 1: 173,215,971 T107A probably benign Het
Olfr5 T A 7: 6,480,331 N275I probably damaging Het
Pacs1 T A 19: 5,145,120 T479S probably benign Het
Pds5b A G 5: 150,778,261 K786E probably damaging Het
Pigp A G 16: 94,370,405 L9P probably benign Het
Plec C T 15: 76,187,746 R707Q unknown Het
Ppef2 T A 5: 92,253,134 H9L possibly damaging Het
Ppid T A 3: 79,600,391 C296S probably damaging Het
Ppp2r5b T G 19: 6,228,484 E465A possibly damaging Het
Ppp4r4 A G 12: 103,596,449 N559S probably damaging Het
Ptprt T C 2: 161,607,305 T873A possibly damaging Het
Rbpms A G 8: 33,866,388 V28A probably damaging Het
Retreg2 A G 1: 75,144,688 M203V probably damaging Het
Rfx4 A G 10: 84,863,349 E367G probably damaging Het
Robo1 C T 16: 72,970,181 P414S probably damaging Het
Sac3d1 T A 19: 6,116,148 E410D probably damaging Het
Scgb2b19 A T 7: 33,279,786 C24S possibly damaging Het
She T C 3: 89,831,612 F37L probably damaging Het
Slc5a2 G A 7: 128,265,805 V37I probably damaging Het
Smyd4 T A 11: 75,390,206 D168E probably benign Het
Ssc5d C A 7: 4,928,573 P260T probably damaging Het
Steap2 A G 5: 5,677,406 F310L probably benign Het
Tctn1 A T 5: 122,248,008 I347N probably damaging Het
Tmtc2 A G 10: 105,370,621 L271P probably damaging Het
Tns3 T A 11: 8,541,192 M122L possibly damaging Het
Ubr7 T G 12: 102,769,139 C286G probably damaging Het
Usp16 T C 16: 87,479,300 S509P probably benign Het
Usp44 A G 10: 93,846,428 T247A probably damaging Het
Vmn2r92 A C 17: 18,167,359 M209L probably benign Het
Wdr34 C T 2: 30,048,778 R31Q probably benign Het
Zc3h6 C T 2: 129,014,553 P518S probably damaging Het
Zfp229 A G 17: 21,745,299 H170R probably damaging Het
Zfp960 A G 17: 17,087,965 T314A probably benign Het
Other mutations in Erc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01302:Erc1 APN 6 119722303 missense probably damaging 0.96
IGL01345:Erc1 APN 6 119761263 nonsense probably null
IGL01370:Erc1 APN 6 119824465 missense probably damaging 1.00
IGL01443:Erc1 APN 6 119824471 missense probably damaging 1.00
IGL01550:Erc1 APN 6 119783394 missense probably damaging 0.96
IGL01798:Erc1 APN 6 119620337 missense possibly damaging 0.86
IGL02032:Erc1 APN 6 119630609 missense probably damaging 1.00
IGL02239:Erc1 APN 6 119773891 missense probably damaging 0.96
IGL02341:Erc1 APN 6 119594973 missense possibly damaging 0.92
couch UTSW 6 119743429 missense possibly damaging 0.81
divan UTSW 6 119753288 missense probably benign 0.27
PIT4498001:Erc1 UTSW 6 119779491 missense possibly damaging 0.92
R0149:Erc1 UTSW 6 119824830 missense probably damaging 1.00
R0277:Erc1 UTSW 6 119620328 missense probably damaging 1.00
R0323:Erc1 UTSW 6 119620328 missense probably damaging 1.00
R1053:Erc1 UTSW 6 119796926 missense probably damaging 1.00
R1252:Erc1 UTSW 6 119743392 missense possibly damaging 0.84
R1355:Erc1 UTSW 6 119743420 nonsense probably null
R1470:Erc1 UTSW 6 119694602 missense probably damaging 1.00
R1470:Erc1 UTSW 6 119694602 missense probably damaging 1.00
R1680:Erc1 UTSW 6 119575761 missense probably damaging 1.00
R1833:Erc1 UTSW 6 119743429 missense possibly damaging 0.81
R1954:Erc1 UTSW 6 119797305 missense probably damaging 1.00
R2037:Erc1 UTSW 6 119722255 missense possibly damaging 0.94
R2365:Erc1 UTSW 6 119575695 missense probably damaging 1.00
R3751:Erc1 UTSW 6 119824960 missense probably damaging 0.99
R4473:Erc1 UTSW 6 119848456 splice site probably null
R4778:Erc1 UTSW 6 119797337 splice site probably null
R4897:Erc1 UTSW 6 119777986 critical splice donor site probably null
R5260:Erc1 UTSW 6 119761159 missense probably damaging 1.00
R5382:Erc1 UTSW 6 119761272 missense probably benign 0.02
R5405:Erc1 UTSW 6 119824944 missense probably damaging 1.00
R5801:Erc1 UTSW 6 119773822 missense probably damaging 0.99
R6341:Erc1 UTSW 6 119777998 missense possibly damaging 0.94
R6588:Erc1 UTSW 6 119575726 missense possibly damaging 0.92
R7441:Erc1 UTSW 6 119824951 missense possibly damaging 0.86
R7486:Erc1 UTSW 6 119594946 nonsense probably null
R7532:Erc1 UTSW 6 119779631 missense probably benign 0.02
R7575:Erc1 UTSW 6 119824760 missense possibly damaging 0.93
R7705:Erc1 UTSW 6 119824603 missense probably benign 0.33
R7740:Erc1 UTSW 6 119761188 missense probably benign 0.02
R7789:Erc1 UTSW 6 119773709 nonsense probably null
R7805:Erc1 UTSW 6 119713771 missense possibly damaging 0.85
R7833:Erc1 UTSW 6 119824486 nonsense probably null
R8039:Erc1 UTSW 6 119773665 nonsense probably null
R8229:Erc1 UTSW 6 119753288 missense probably benign 0.27
R8363:Erc1 UTSW 6 119753299 missense probably benign 0.00
R8794:Erc1 UTSW 6 119630655 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TGTCTGCAGATCCATGATGG -3'
(R):5'- TGCTCGATCAGTAGGGAAGG -3'

Sequencing Primer
(F):5'- CTGCAGATCCATGATGGTGTTATCTC -3'
(R):5'- TCGCTTAGGTCATCGGCGAAC -3'
Posted On2019-10-24