Incidental Mutation 'R0620:Kdm5d'
ID 58642
Institutional Source Beutler Lab
Gene Symbol Kdm5d
Ensembl Gene ENSMUSG00000056673
Gene Name lysine (K)-specific demethylase 5D
Synonyms Jarid1d, Smcy, HY
MMRRC Submission 038809-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.071) question?
Stock # R0620 (G1)
Quality Score 225
Status Validated
Chromosome Y
Chromosomal Location 897788-956786 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 927330 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Methionine to Lysine at position 650 (M650K)
Ref Sequence ENSEMBL: ENSMUSP00000140663 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055032] [ENSMUST00000186696] [ENSMUST00000186726]
AlphaFold Q62240
Predicted Effect probably damaging
Transcript: ENSMUST00000055032
AA Change: M650K

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000061095
Gene: ENSMUSG00000056673
AA Change: M650K

DomainStartEndE-ValueType
JmjN 13 54 3.45e-23 SMART
ARID 76 165 4.84e-36 SMART
BRIGHT 80 170 4.48e-38 SMART
PHD 325 371 8.56e-13 SMART
JmjC 467 633 2.52e-63 SMART
Pfam:zf-C5HC2 706 758 5.2e-18 PFAM
Pfam:PLU-1 771 1096 1.4e-89 PFAM
low complexity region 1147 1156 N/A INTRINSIC
low complexity region 1164 1181 N/A INTRINSIC
PHD 1182 1243 2.54e-6 SMART
coiled coil region 1290 1318 N/A INTRINSIC
low complexity region 1340 1351 N/A INTRINSIC
low complexity region 1395 1406 N/A INTRINSIC
low complexity region 1453 1459 N/A INTRINSIC
low complexity region 1525 1541 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000186696
AA Change: M650K

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000140663
Gene: ENSMUSG00000056673
AA Change: M650K

DomainStartEndE-ValueType
JmjN 13 54 3.45e-23 SMART
ARID 76 165 4.84e-36 SMART
BRIGHT 80 170 4.48e-38 SMART
PHD 325 371 8.56e-13 SMART
JmjC 467 633 2.52e-63 SMART
low complexity region 675 689 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000186726
SMART Domains Protein: ENSMUSP00000140462
Gene: ENSMUSG00000056673

DomainStartEndE-ValueType
JmjN 13 54 1.4e-25 SMART
ARID 76 165 3.8e-40 SMART
BRIGHT 80 170 2.3e-40 SMART
Blast:ARID 175 260 1e-41 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000187296
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 99.0%
  • 10x: 97.8%
  • 20x: 96.1%
Validation Efficiency 100% (74/74)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein containing zinc finger domains. A short peptide derived from this protein is a minor histocompatibility antigen which can lead to graft rejection of male donor cells in a female recipient. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2009]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810474O19Rik A T 6: 149,328,375 Q973L probably damaging Het
Adamts9 T C 6: 92,858,113 T679A possibly damaging Het
Ahr T C 12: 35,508,194 T276A probably benign Het
Akap9 A T 5: 4,064,136 Q3138H probably damaging Het
Armt1 T A 10: 4,432,689 F7I probably benign Het
B3galt2 A G 1: 143,646,140 R5G probably damaging Het
Bod1l T C 5: 41,801,233 N2750S probably benign Het
Cadps2 T A 6: 23,583,396 E365V probably damaging Het
Cd200r3 T A 16: 44,957,717 probably null Het
Cst7 T A 2: 150,575,886 probably benign Het
Defb30 A T 14: 63,049,763 probably benign Het
Dido1 C T 2: 180,659,851 G2087S probably benign Het
Dio2 A G 12: 90,738,071 Y72H probably benign Het
Dnah11 C T 12: 117,987,469 E3035K probably damaging Het
Dnajb13 T C 7: 100,503,249 K287E possibly damaging Het
Dnajc11 G A 4: 151,973,628 V244I possibly damaging Het
Ect2 C T 3: 27,139,652 A226T probably damaging Het
Ercc8 G A 13: 108,174,061 probably null Het
Fam120b T A 17: 15,402,927 M389K probably benign Het
Fam151a A G 4: 106,747,931 M497V probably benign Het
Fam186b C A 15: 99,280,128 G439V probably benign Het
Fank1 A G 7: 133,876,765 Y185C probably damaging Het
Gart T C 16: 91,630,602 probably benign Het
Glb1l T C 1: 75,199,720 Y572C probably damaging Het
Gm11563 C T 11: 99,658,437 A164T unknown Het
Gnb4 C T 3: 32,591,207 V112I probably benign Het
Gsdmc3 T A 15: 63,859,693 D330V probably damaging Het
H2-DMa C T 17: 34,137,960 T144M probably damaging Het
Haus6 A T 4: 86,583,514 F707I possibly damaging Het
Hmcn1 T A 1: 150,594,016 T4971S probably benign Het
Ints6 A T 14: 62,696,759 F766L probably benign Het
Kif21b T C 1: 136,159,428 F881S possibly damaging Het
Klrk1 C A 6: 129,614,635 Q176H possibly damaging Het
Ky T C 9: 102,537,621 V244A probably benign Het
Mia2 T A 12: 59,154,419 L191M possibly damaging Het
Miga2 T A 2: 30,381,744 probably benign Het
Mtss1l C T 8: 110,737,948 P322S probably damaging Het
Nalcn A G 14: 123,299,141 probably benign Het
Ncbp3 T A 11: 73,049,845 probably benign Het
Nprl3 G A 11: 32,234,876 L378F probably damaging Het
Ntrk2 A T 13: 58,846,821 M184L probably benign Het
Olfr311 T G 11: 58,841,443 C110G probably damaging Het
Olfr738 G T 14: 50,413,697 C51F probably benign Het
Osbpl9 T C 4: 109,083,128 E287G probably damaging Het
Parva T C 7: 112,576,411 F250L probably damaging Het
Pcdhb11 C T 18: 37,421,811 Q65* probably null Het
Phtf1 A G 3: 103,993,765 T377A probably damaging Het
Pkp4 G A 2: 59,322,643 V612I possibly damaging Het
Plscr2 C A 9: 92,287,654 S52R probably benign Het
Pnisr C T 4: 21,874,092 probably benign Het
Pole2 A C 12: 69,209,879 S291A probably damaging Het
Ppp2r5d A G 17: 46,684,018 F586L probably benign Het
Prrx1 G A 1: 163,257,816 R182C probably damaging Het
Ptprs A G 17: 56,429,103 I110T possibly damaging Het
Rasgrf2 G A 13: 91,919,817 probably benign Het
Riox2 T C 16: 59,491,892 V464A probably benign Het
Robo2 A G 16: 73,967,802 V646A possibly damaging Het
Ros1 T A 10: 52,118,348 I1279F probably damaging Het
Siglec1 G A 2: 131,074,268 T1254M probably benign Het
Snx7 T C 3: 117,846,675 N62D probably damaging Het
Sp100 G A 1: 85,659,867 probably null Het
Stil A T 4: 115,007,159 I86L possibly damaging Het
Tbc1d16 T A 11: 119,209,038 D170V probably benign Het
Tmem2 T A 19: 21,817,971 S743T probably benign Het
Trappc13 G A 13: 104,161,081 T105M probably damaging Het
Trhr T A 15: 44,229,500 S378T probably benign Het
Ttc7b T C 12: 100,500,073 probably null Het
Vegfc A T 8: 54,157,139 Y110F probably benign Het
Vmn1r184 C A 7: 26,267,177 P116H possibly damaging Het
Vmn2r5 A T 3: 64,503,814 C444* probably null Het
Zfp341 A G 2: 154,634,273 E460G possibly damaging Het
Zfp819 T A 7: 43,616,444 V41E probably benign Het
Other mutations in Kdm5d
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0013:Kdm5d UTSW Y 941715 missense probably benign 0.37
R0013:Kdm5d UTSW Y 941715 missense probably benign 0.37
R0426:Kdm5d UTSW Y 942437 splice site probably benign
R0486:Kdm5d UTSW Y 927107 missense probably damaging 1.00
R0781:Kdm5d UTSW Y 910539 missense probably damaging 1.00
R1015:Kdm5d UTSW Y 941687 missense possibly damaging 0.95
R1110:Kdm5d UTSW Y 910539 missense probably damaging 1.00
R1163:Kdm5d UTSW Y 898029 missense probably benign 0.18
R1203:Kdm5d UTSW Y 941011 missense probably damaging 1.00
R1238:Kdm5d UTSW Y 941282 missense probably damaging 1.00
R1723:Kdm5d UTSW Y 927753 missense probably damaging 1.00
R1842:Kdm5d UTSW Y 927798 missense probably damaging 1.00
R1885:Kdm5d UTSW Y 940781 splice site probably null
R2131:Kdm5d UTSW Y 941483 missense probably benign 0.02
R2571:Kdm5d UTSW Y 940932 missense probably benign 0.11
R2931:Kdm5d UTSW Y 942992 missense probably benign 0.18
R3123:Kdm5d UTSW Y 900558 missense possibly damaging 0.63
R3919:Kdm5d UTSW Y 939914 missense probably damaging 1.00
R4018:Kdm5d UTSW Y 910441 splice site probably benign
R4031:Kdm5d UTSW Y 916910 missense probably damaging 1.00
R4403:Kdm5d UTSW Y 899830 missense probably damaging 1.00
R4571:Kdm5d UTSW Y 927110 missense probably damaging 1.00
R4583:Kdm5d UTSW Y 914134 missense probably damaging 1.00
R4962:Kdm5d UTSW Y 940624 missense probably damaging 1.00
R5105:Kdm5d UTSW Y 941752 missense probably benign 0.00
R5249:Kdm5d UTSW Y 916692 missense probably damaging 1.00
R5367:Kdm5d UTSW Y 941645 missense probably benign 0.05
R5373:Kdm5d UTSW Y 927995 missense probably benign 0.09
R5374:Kdm5d UTSW Y 927995 missense probably benign 0.09
R5876:Kdm5d UTSW Y 900525 missense probably damaging 1.00
R5909:Kdm5d UTSW Y 941306 missense probably benign 0.01
R6014:Kdm5d UTSW Y 921528 missense probably benign 0.45
R6109:Kdm5d UTSW Y 921501 missense probably damaging 1.00
R6251:Kdm5d UTSW Y 921693 missense probably damaging 1.00
R6349:Kdm5d UTSW Y 916847 missense probably damaging 0.99
R6450:Kdm5d UTSW Y 927056 missense probably damaging 1.00
R6595:Kdm5d UTSW Y 939829 missense probably benign
R6628:Kdm5d UTSW Y 900525 missense probably damaging 1.00
R6745:Kdm5d UTSW Y 927112 missense probably benign 0.28
R6867:Kdm5d UTSW Y 927425 missense probably benign
R6963:Kdm5d UTSW Y 937975 missense probably benign 0.01
R7163:Kdm5d UTSW Y 899940 missense probably damaging 1.00
R7374:Kdm5d UTSW Y 941491 missense probably benign 0.41
R7483:Kdm5d UTSW Y 914044 missense possibly damaging 0.50
R7501:Kdm5d UTSW Y 941488 missense probably damaging 1.00
R7815:Kdm5d UTSW Y 940702 missense probably damaging 1.00
R7835:Kdm5d UTSW Y 900558 missense possibly damaging 0.63
R8057:Kdm5d UTSW Y 927355 missense possibly damaging 0.48
R8080:Kdm5d UTSW Y 910742 missense probably benign 0.01
R8130:Kdm5d UTSW Y 940658 missense possibly damaging 0.75
R8213:Kdm5d UTSW Y 941515 missense probably damaging 1.00
R8261:Kdm5d UTSW Y 936929 missense probably damaging 0.99
R8344:Kdm5d UTSW Y 942477 missense probably benign 0.05
R8348:Kdm5d UTSW Y 914056 missense probably benign 0.00
R8445:Kdm5d UTSW Y 916874 missense probably damaging 1.00
R8448:Kdm5d UTSW Y 914056 missense probably benign 0.00
R8754:Kdm5d UTSW Y 941594 missense probably damaging 1.00
R9203:Kdm5d UTSW Y 940981 missense probably damaging 0.99
R9259:Kdm5d UTSW Y 942640 missense possibly damaging 0.84
Predicted Primers PCR Primer
(F):5'- CGTGCTTACCACAGTGGCTTTAACC -3'
(R):5'- ACTAGGAGCAGTGTTCTGGACACC -3'

Sequencing Primer
(F):5'- CAAGGCTATAACTTTGCTGAGGC -3'
(R):5'- AATACTGAGCCCTGCTGTG -3'
Posted On 2013-07-11