Incidental Mutation 'R7576:Slc5a2'
ID586425
Institutional Source Beutler Lab
Gene Symbol Slc5a2
Ensembl Gene ENSMUSG00000030781
Gene Namesolute carrier family 5 (sodium/glucose cotransporter), member 2
SynonymsSglt2
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7576 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location128265657-128272430 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 128265805 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 37 (V37I)
Ref Sequence ENSEMBL: ENSMUSP00000112597 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033045] [ENSMUST00000118169] [ENSMUST00000137038] [ENSMUST00000142841] [ENSMUST00000153418] [ENSMUST00000205720] [ENSMUST00000206909]
Predicted Effect probably benign
Transcript: ENSMUST00000033045
Predicted Effect probably damaging
Transcript: ENSMUST00000118169
AA Change: V37I

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000112597
Gene: ENSMUSG00000030781
AA Change: V37I

DomainStartEndE-ValueType
Pfam:SSF 53 490 7e-170 PFAM
transmembrane domain 524 546 N/A INTRINSIC
low complexity region 566 577 N/A INTRINSIC
low complexity region 615 635 N/A INTRINSIC
transmembrane domain 650 669 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000137038
SMART Domains Protein: ENSMUSP00000124318
Gene: ENSMUSG00000030781

DomainStartEndE-ValueType
Pfam:SSF 1 103 3.3e-41 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000142841
AA Change: V37I

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000115451
Gene: ENSMUSG00000030781
AA Change: V37I

DomainStartEndE-ValueType
Pfam:SSF 53 276 5.7e-81 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000153418
Predicted Effect probably damaging
Transcript: ENSMUST00000205720
AA Change: V37I

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
Predicted Effect probably benign
Transcript: ENSMUST00000206703
Predicted Effect probably benign
Transcript: ENSMUST00000206716
Predicted Effect probably damaging
Transcript: ENSMUST00000206909
AA Change: V37I

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the sodium glucose cotransporter family which are sodium-dependent glucose transport proteins. The encoded protein is the major cotransporter involved in glucose reabsorption in the kidney. Mutations in this gene are associated with renal glucosuria. Two transcript variants, one protein-coding and one not, have been found for this gene. [provided by RefSeq, Feb 2015]
PHENOTYPE: Mice homozygous for a null allele exhibit increased urine glucose, increased eating and drinking behaviors, increased circulating renin activity, decreased urine osmolality, decreased serum aldosterone levels, polyuria, and decreased glucose renal reabsorption. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ahdc1 A T 4: 133,065,002 S1185C possibly damaging Het
Akap9 C G 5: 3,968,745 H1109D probably benign Het
Alpk2 T C 18: 65,306,816 D502G possibly damaging Het
Bcl2 A G 1: 106,712,423 V153A possibly damaging Het
Brinp3 A T 1: 146,901,563 S583C probably damaging Het
Calr4 A T 4: 109,238,964 Q113L probably benign Het
Carm1 T G 9: 21,586,536 probably null Het
Ccdc30 A G 4: 119,349,866 L353P probably damaging Het
Ccdc91 C G 6: 147,590,459 Q280E unknown Het
Cdk5rap2 T C 4: 70,266,872 T1114A probably benign Het
Enpep T A 3: 129,284,091 T626S probably benign Het
Epcam T C 17: 87,640,293 S64P probably damaging Het
Erc1 G T 6: 119,824,760 P99T possibly damaging Het
Fastkd1 A G 2: 69,694,644 L636S probably damaging Het
Fmn1 A G 2: 113,365,008 D351G unknown Het
Fndc8 T G 11: 82,897,574 S77A probably damaging Het
Gbp10 G A 5: 105,236,149 probably benign Het
Gemin6 T A 17: 80,225,726 Y29* probably null Het
Gja8 T C 3: 96,919,893 E151G probably benign Het
Gje1 A G 10: 14,716,757 Y94H probably damaging Het
Glt6d1 A G 2: 25,814,122 F26S probably benign Het
Gltpd2 T A 11: 70,519,480 probably null Het
Gm10153 A C 7: 142,190,122 C70G unknown Het
Gm28729 G A 9: 96,494,357 T368M probably damaging Het
Gm4559 A G 7: 142,273,940 C142R unknown Het
Golm1 T C 13: 59,645,106 N195S probably benign Het
Hectd4 A T 5: 121,349,459 S3506C possibly damaging Het
Hnrnpll G A 17: 80,044,514 S334L possibly damaging Het
Ighv7-3 A T 12: 114,153,245 I99N possibly damaging Het
Igkv8-24 A G 6: 70,217,018 S69P not run Het
Ilvbl A T 10: 78,583,697 H537L possibly damaging Het
Lama1 G A 17: 67,782,041 G1569D Het
Lin7b A T 7: 45,369,225 Y118* probably null Het
Mansc1 T A 6: 134,610,711 S168C possibly damaging Het
Mast3 A G 8: 70,781,194 V969A probably damaging Het
Muc4 C T 16: 32,754,500 T1458I probably benign Het
Myh10 A G 11: 68,802,166 E1429G probably damaging Het
Narfl A C 17: 25,778,970 T154P probably damaging Het
Neurod1 G T 2: 79,454,345 Y231* probably null Het
Nrxn2 G T 19: 6,531,510 E1492* probably null Het
Nwd2 A G 5: 63,807,393 Q1440R probably benign Het
Olfr1038-ps A G 2: 86,122,376 Y151C probably damaging Het
Olfr1404 A G 1: 173,215,971 T107A probably benign Het
Olfr5 T A 7: 6,480,331 N275I probably damaging Het
Pacs1 T A 19: 5,145,120 T479S probably benign Het
Pds5b A G 5: 150,778,261 K786E probably damaging Het
Pigp A G 16: 94,370,405 L9P probably benign Het
Plec C T 15: 76,187,746 R707Q unknown Het
Ppef2 T A 5: 92,253,134 H9L possibly damaging Het
Ppid T A 3: 79,600,391 C296S probably damaging Het
Ppp2r5b T G 19: 6,228,484 E465A possibly damaging Het
Ppp4r4 A G 12: 103,596,449 N559S probably damaging Het
Ptprt T C 2: 161,607,305 T873A possibly damaging Het
Rbpms A G 8: 33,866,388 V28A probably damaging Het
Retreg2 A G 1: 75,144,688 M203V probably damaging Het
Rfx4 A G 10: 84,863,349 E367G probably damaging Het
Robo1 C T 16: 72,970,181 P414S probably damaging Het
Sac3d1 T A 19: 6,116,148 E410D probably damaging Het
Scgb2b19 A T 7: 33,279,786 C24S possibly damaging Het
She T C 3: 89,831,612 F37L probably damaging Het
Smyd4 T A 11: 75,390,206 D168E probably benign Het
Ssc5d C A 7: 4,928,573 P260T probably damaging Het
Steap2 A G 5: 5,677,406 F310L probably benign Het
Tctn1 A T 5: 122,248,008 I347N probably damaging Het
Tmtc2 A G 10: 105,370,621 L271P probably damaging Het
Tns3 T A 11: 8,541,192 M122L possibly damaging Het
Ubr7 T G 12: 102,769,139 C286G probably damaging Het
Usp16 T C 16: 87,479,300 S509P probably benign Het
Usp44 A G 10: 93,846,428 T247A probably damaging Het
Vmn2r92 A C 17: 18,167,359 M209L probably benign Het
Wdr34 C T 2: 30,048,778 R31Q probably benign Het
Zc3h6 C T 2: 129,014,553 P518S probably damaging Het
Zfp229 A G 17: 21,745,299 H170R probably damaging Het
Zfp960 A G 17: 17,087,965 T314A probably benign Het
Other mutations in Slc5a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01511:Slc5a2 APN 7 128270622 missense probably benign 0.07
IGL03084:Slc5a2 APN 7 128266604 missense probably benign 0.25
dregs UTSW 7 128267505 splice site probably null
jimbee UTSW 7 large deletion
R0026:Slc5a2 UTSW 7 128270053 missense probably damaging 1.00
R0395:Slc5a2 UTSW 7 128267482 missense probably damaging 1.00
R0544:Slc5a2 UTSW 7 128269999 missense probably damaging 1.00
R0762:Slc5a2 UTSW 7 128267482 missense probably damaging 1.00
R0966:Slc5a2 UTSW 7 128270631 missense probably damaging 1.00
R0968:Slc5a2 UTSW 7 128270631 missense probably damaging 1.00
R1382:Slc5a2 UTSW 7 128270631 missense probably damaging 1.00
R1383:Slc5a2 UTSW 7 128270631 missense probably damaging 1.00
R1385:Slc5a2 UTSW 7 128270631 missense probably damaging 1.00
R1467:Slc5a2 UTSW 7 128271256 unclassified probably benign
R4836:Slc5a2 UTSW 7 128267505 splice site probably null
R4983:Slc5a2 UTSW 7 128271810 makesense probably null
R5703:Slc5a2 UTSW 7 128270615 missense possibly damaging 0.77
R6185:Slc5a2 UTSW 7 128271177 missense probably damaging 0.98
R6696:Slc5a2 UTSW 7 128270043 missense probably damaging 1.00
R6969:Slc5a2 UTSW 7 128272077 missense probably benign 0.00
R7062:Slc5a2 UTSW 7 128270040 missense probably damaging 0.99
R7747:Slc5a2 UTSW 7 128266395 synonymous probably null
R7802:Slc5a2 UTSW 7 128271798 missense possibly damaging 0.80
R8027:Slc5a2 UTSW 7 128270546 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CGGCCTTGATAGATCCTGATTC -3'
(R):5'- TGCACAATCCAGAAGGTACG -3'

Sequencing Primer
(F):5'- CAGTGCTCCTGAGGTAACCATTAATC -3'
(R):5'- GCACAATCCAGAAGGTACGAAGAC -3'
Posted On2019-10-24