Incidental Mutation 'R7576:Mast3'
ID 586429
Institutional Source Beutler Lab
Gene Symbol Mast3
Ensembl Gene ENSMUSG00000031833
Gene Name microtubule associated serine/threonine kinase 3
Synonyms
MMRRC Submission 045661-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R7576 (G1)
Quality Score 225.009
Status Not validated
Chromosome 8
Chromosomal Location 71230761-71257681 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 71233838 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 969 (V969A)
Ref Sequence ENSEMBL: ENSMUSP00000148686 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034296] [ENSMUST00000166004] [ENSMUST00000211948]
AlphaFold Q3U214
Predicted Effect probably benign
Transcript: ENSMUST00000034296
SMART Domains Protein: ENSMUSP00000034296
Gene: ENSMUSG00000031834

DomainStartEndE-ValueType
SH3 7 79 4e-7 SMART
RhoGAP 122 286 2.36e-18 SMART
low complexity region 291 311 N/A INTRINSIC
SH2 322 405 4.51e-26 SMART
Pfam:PI3K_P85_iSH2 422 590 1.7e-64 PFAM
SH2 614 696 9.96e-28 SMART
low complexity region 713 718 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142370
Predicted Effect probably damaging
Transcript: ENSMUST00000166004
AA Change: V985A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000128703
Gene: ENSMUSG00000031833
AA Change: V985A

DomainStartEndE-ValueType
low complexity region 43 59 N/A INTRINSIC
Pfam:DUF1908 64 337 4.4e-128 PFAM
S_TKc 373 646 2.77e-99 SMART
S_TK_X 647 710 2.39e-1 SMART
low complexity region 820 833 N/A INTRINSIC
low complexity region 910 942 N/A INTRINSIC
PDZ 958 1038 3.8e-15 SMART
low complexity region 1053 1074 N/A INTRINSIC
low complexity region 1089 1121 N/A INTRINSIC
low complexity region 1124 1150 N/A INTRINSIC
low complexity region 1180 1204 N/A INTRINSIC
low complexity region 1231 1248 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191396
Predicted Effect probably damaging
Transcript: ENSMUST00000211948
AA Change: V969A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212172
Meta Mutation Damage Score 0.4779 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
Allele List at MGI

All alleles(2) : Targeted(1) Gene trapped(1)

Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ahdc1 A T 4: 132,792,313 (GRCm39) S1185C possibly damaging Het
Akap9 C G 5: 4,018,745 (GRCm39) H1109D probably benign Het
Alpk2 T C 18: 65,439,887 (GRCm39) D502G possibly damaging Het
Bcl2 A G 1: 106,640,153 (GRCm39) V153A possibly damaging Het
Brinp3 A T 1: 146,777,301 (GRCm39) S583C probably damaging Het
Calr4 A T 4: 109,096,161 (GRCm39) Q113L probably benign Het
Carm1 T G 9: 21,497,832 (GRCm39) probably null Het
Ccdc30 A G 4: 119,207,063 (GRCm39) L353P probably damaging Het
Ccdc91 C G 6: 147,491,957 (GRCm39) Q280E unknown Het
Cdk5rap2 T C 4: 70,185,109 (GRCm39) T1114A probably benign Het
Ciao3 A C 17: 25,997,944 (GRCm39) T154P probably damaging Het
Dync2i2 C T 2: 29,938,790 (GRCm39) R31Q probably benign Het
Enpep T A 3: 129,077,740 (GRCm39) T626S probably benign Het
Epcam T C 17: 87,947,721 (GRCm39) S64P probably damaging Het
Erc1 G T 6: 119,801,721 (GRCm39) P99T possibly damaging Het
Fastkd1 A G 2: 69,524,988 (GRCm39) L636S probably damaging Het
Fmn1 A G 2: 113,195,353 (GRCm39) D351G unknown Het
Fndc8 T G 11: 82,788,400 (GRCm39) S77A probably damaging Het
Gbp10 G A 5: 105,384,015 (GRCm39) probably benign Het
Gemin6 T A 17: 80,533,155 (GRCm39) Y29* probably null Het
Gja8 T C 3: 96,827,209 (GRCm39) E151G probably benign Het
Gje1 A G 10: 14,592,501 (GRCm39) Y94H probably damaging Het
Glt6d1 A G 2: 25,704,134 (GRCm39) F26S probably benign Het
Gltpd2 T A 11: 70,410,306 (GRCm39) probably null Het
Gm10153 A C 7: 141,743,859 (GRCm39) C70G unknown Het
Gm28729 G A 9: 96,376,410 (GRCm39) T368M probably damaging Het
Gm4559 A G 7: 141,827,677 (GRCm39) C142R unknown Het
Golm1 T C 13: 59,792,920 (GRCm39) N195S probably benign Het
Hectd4 A T 5: 121,487,522 (GRCm39) S3506C possibly damaging Het
Hnrnpll G A 17: 80,351,943 (GRCm39) S334L possibly damaging Het
Ighv7-3 A T 12: 114,116,865 (GRCm39) I99N possibly damaging Het
Igkv8-24 A G 6: 70,194,002 (GRCm39) S69P not run Het
Ilvbl A T 10: 78,419,531 (GRCm39) H537L possibly damaging Het
Lama1 G A 17: 68,089,036 (GRCm39) G1569D Het
Lin7b A T 7: 45,018,649 (GRCm39) Y118* probably null Het
Mansc1 T A 6: 134,587,674 (GRCm39) S168C possibly damaging Het
Muc4 C T 16: 32,754,500 (GRCm38) T1458I probably benign Het
Myh10 A G 11: 68,692,992 (GRCm39) E1429G probably damaging Het
Neurod1 G T 2: 79,284,689 (GRCm39) Y231* probably null Het
Nrxn2 G T 19: 6,581,540 (GRCm39) E1492* probably null Het
Nwd2 A G 5: 63,964,736 (GRCm39) Q1440R probably benign Het
Or10j3b A G 1: 173,043,538 (GRCm39) T107A probably benign Het
Or6z7 T A 7: 6,483,330 (GRCm39) N275I probably damaging Het
Or8u3-ps A G 2: 85,952,720 (GRCm39) Y151C probably damaging Het
Pacs1 T A 19: 5,195,148 (GRCm39) T479S probably benign Het
Pds5b A G 5: 150,701,726 (GRCm39) K786E probably damaging Het
Pigp A G 16: 94,171,264 (GRCm39) L9P probably benign Het
Plec C T 15: 76,071,946 (GRCm39) R707Q unknown Het
Ppef2 T A 5: 92,400,993 (GRCm39) H9L possibly damaging Het
Ppid T A 3: 79,507,698 (GRCm39) C296S probably damaging Het
Ppp2r5b T G 19: 6,278,514 (GRCm39) E465A possibly damaging Het
Ppp4r4 A G 12: 103,562,708 (GRCm39) N559S probably damaging Het
Ptprt T C 2: 161,449,225 (GRCm39) T873A possibly damaging Het
Rbpms A G 8: 34,356,416 (GRCm39) V28A probably damaging Het
Retreg2 A G 1: 75,121,332 (GRCm39) M203V probably damaging Het
Rfx4 A G 10: 84,699,213 (GRCm39) E367G probably damaging Het
Robo1 C T 16: 72,767,069 (GRCm39) P414S probably damaging Het
Sac3d1 T A 19: 6,166,178 (GRCm39) E410D probably damaging Het
Scgb2b19 A T 7: 32,979,211 (GRCm39) C24S possibly damaging Het
She T C 3: 89,738,919 (GRCm39) F37L probably damaging Het
Slc5a2 G A 7: 127,864,977 (GRCm39) V37I probably damaging Het
Smyd4 T A 11: 75,281,032 (GRCm39) D168E probably benign Het
Ssc5d C A 7: 4,931,572 (GRCm39) P260T probably damaging Het
Steap2 A G 5: 5,727,406 (GRCm39) F310L probably benign Het
Tctn1 A T 5: 122,386,071 (GRCm39) I347N probably damaging Het
Tmtc2 A G 10: 105,206,482 (GRCm39) L271P probably damaging Het
Tns3 T A 11: 8,491,192 (GRCm39) M122L possibly damaging Het
Ubr7 T G 12: 102,735,398 (GRCm39) C286G probably damaging Het
Usp16 T C 16: 87,276,188 (GRCm39) S509P probably benign Het
Usp44 A G 10: 93,682,290 (GRCm39) T247A probably damaging Het
Vmn2r92 A C 17: 18,387,621 (GRCm39) M209L probably benign Het
Zc3h6 C T 2: 128,856,473 (GRCm39) P518S probably damaging Het
Zfp229 A G 17: 21,964,280 (GRCm39) H170R probably damaging Het
Zfp960 A G 17: 17,308,227 (GRCm39) T314A probably benign Het
Other mutations in Mast3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00952:Mast3 APN 8 71,233,327 (GRCm39) splice site probably benign
IGL01411:Mast3 APN 8 71,232,227 (GRCm39) missense possibly damaging 0.50
IGL01475:Mast3 APN 8 71,232,174 (GRCm39) missense probably damaging 1.00
IGL01886:Mast3 APN 8 71,234,783 (GRCm39) missense possibly damaging 0.94
IGL02104:Mast3 APN 8 71,240,550 (GRCm39) missense possibly damaging 0.78
IGL02236:Mast3 APN 8 71,241,888 (GRCm39) missense probably benign 0.36
IGL02437:Mast3 APN 8 71,233,202 (GRCm39) missense possibly damaging 0.79
IGL02704:Mast3 APN 8 71,239,519 (GRCm39) missense probably damaging 1.00
IGL03155:Mast3 APN 8 71,241,861 (GRCm39) missense probably damaging 1.00
IGL03366:Mast3 APN 8 71,234,207 (GRCm39) nonsense probably null
gravy UTSW 8 71,239,279 (GRCm39) missense probably damaging 1.00
stuffing UTSW 8 71,237,441 (GRCm39) frame shift probably null
turkey UTSW 8 71,238,126 (GRCm39) missense probably damaging 1.00
BB010:Mast3 UTSW 8 71,239,279 (GRCm39) missense probably damaging 1.00
BB020:Mast3 UTSW 8 71,239,279 (GRCm39) missense probably damaging 1.00
R0037:Mast3 UTSW 8 71,236,343 (GRCm39) critical splice donor site probably null
R0280:Mast3 UTSW 8 71,240,564 (GRCm39) missense possibly damaging 0.65
R0280:Mast3 UTSW 8 71,236,439 (GRCm39) missense probably damaging 1.00
R0731:Mast3 UTSW 8 71,233,965 (GRCm39) missense probably damaging 1.00
R1101:Mast3 UTSW 8 71,239,307 (GRCm39) missense probably damaging 1.00
R1177:Mast3 UTSW 8 71,232,968 (GRCm39) missense probably damaging 1.00
R1208:Mast3 UTSW 8 71,240,916 (GRCm39) splice site probably null
R1208:Mast3 UTSW 8 71,240,916 (GRCm39) splice site probably null
R1333:Mast3 UTSW 8 71,233,938 (GRCm39) missense probably damaging 1.00
R1543:Mast3 UTSW 8 71,244,955 (GRCm39) missense possibly damaging 0.93
R1544:Mast3 UTSW 8 71,238,816 (GRCm39) missense probably damaging 1.00
R1738:Mast3 UTSW 8 71,237,200 (GRCm39) missense probably benign 0.38
R1842:Mast3 UTSW 8 71,233,037 (GRCm39) missense possibly damaging 0.91
R1936:Mast3 UTSW 8 71,237,444 (GRCm39) missense probably damaging 1.00
R2015:Mast3 UTSW 8 71,240,007 (GRCm39) missense probably benign 0.00
R2219:Mast3 UTSW 8 71,233,607 (GRCm39) missense probably damaging 0.99
R2220:Mast3 UTSW 8 71,233,607 (GRCm39) missense probably damaging 0.99
R3711:Mast3 UTSW 8 71,232,251 (GRCm39) missense probably benign 0.13
R3919:Mast3 UTSW 8 71,232,066 (GRCm39) missense probably benign 0.02
R4027:Mast3 UTSW 8 71,240,552 (GRCm39) missense probably damaging 1.00
R4060:Mast3 UTSW 8 71,233,838 (GRCm39) missense probably damaging 1.00
R4061:Mast3 UTSW 8 71,233,838 (GRCm39) missense probably damaging 1.00
R4062:Mast3 UTSW 8 71,233,838 (GRCm39) missense probably damaging 1.00
R4063:Mast3 UTSW 8 71,233,838 (GRCm39) missense probably damaging 1.00
R4588:Mast3 UTSW 8 71,233,251 (GRCm39) nonsense probably null
R4672:Mast3 UTSW 8 71,237,441 (GRCm39) frame shift probably null
R4770:Mast3 UTSW 8 71,238,864 (GRCm39) missense probably damaging 1.00
R4822:Mast3 UTSW 8 71,233,010 (GRCm39) missense probably damaging 1.00
R4830:Mast3 UTSW 8 71,241,559 (GRCm39) missense possibly damaging 0.87
R5196:Mast3 UTSW 8 71,240,889 (GRCm39) missense probably damaging 1.00
R5333:Mast3 UTSW 8 71,236,145 (GRCm39) missense probably benign 0.03
R5428:Mast3 UTSW 8 71,237,377 (GRCm39) missense possibly damaging 0.95
R5656:Mast3 UTSW 8 71,238,865 (GRCm39) missense probably damaging 1.00
R5920:Mast3 UTSW 8 71,240,577 (GRCm39) missense probably benign 0.00
R6177:Mast3 UTSW 8 71,242,662 (GRCm39) missense probably damaging 1.00
R6186:Mast3 UTSW 8 71,238,127 (GRCm39) missense probably damaging 1.00
R6407:Mast3 UTSW 8 71,234,772 (GRCm39) missense probably benign 0.02
R6614:Mast3 UTSW 8 71,234,610 (GRCm39) missense possibly damaging 0.95
R6804:Mast3 UTSW 8 71,239,376 (GRCm39) missense probably benign 0.29
R6873:Mast3 UTSW 8 71,239,236 (GRCm39) nonsense probably null
R6930:Mast3 UTSW 8 71,252,115 (GRCm39) nonsense probably null
R6948:Mast3 UTSW 8 71,238,126 (GRCm39) missense probably damaging 1.00
R7084:Mast3 UTSW 8 71,232,117 (GRCm39) missense probably benign 0.14
R7253:Mast3 UTSW 8 71,242,326 (GRCm39) critical splice donor site probably null
R7316:Mast3 UTSW 8 71,232,432 (GRCm39) missense probably damaging 1.00
R7357:Mast3 UTSW 8 71,237,503 (GRCm39) missense probably damaging 1.00
R7405:Mast3 UTSW 8 71,238,815 (GRCm39) missense probably damaging 1.00
R7429:Mast3 UTSW 8 71,232,947 (GRCm39) missense probably damaging 1.00
R7430:Mast3 UTSW 8 71,232,947 (GRCm39) missense probably damaging 1.00
R7521:Mast3 UTSW 8 71,241,412 (GRCm39) missense probably benign 0.16
R7933:Mast3 UTSW 8 71,239,279 (GRCm39) missense probably damaging 1.00
R7998:Mast3 UTSW 8 71,236,214 (GRCm39) missense probably benign
R8021:Mast3 UTSW 8 71,240,896 (GRCm39) missense probably benign 0.02
R8204:Mast3 UTSW 8 71,240,925 (GRCm39) missense probably benign 0.00
R8327:Mast3 UTSW 8 71,232,062 (GRCm39) missense probably damaging 1.00
R8357:Mast3 UTSW 8 71,233,085 (GRCm39) missense probably benign 0.39
R8415:Mast3 UTSW 8 71,233,866 (GRCm39) missense probably damaging 1.00
R8457:Mast3 UTSW 8 71,233,085 (GRCm39) missense probably benign 0.39
R8530:Mast3 UTSW 8 71,240,877 (GRCm39) missense possibly damaging 0.92
R8891:Mast3 UTSW 8 71,233,801 (GRCm39) missense probably damaging 1.00
R8930:Mast3 UTSW 8 71,234,377 (GRCm39) splice site probably benign
R9002:Mast3 UTSW 8 71,233,904 (GRCm39) missense probably damaging 1.00
R9085:Mast3 UTSW 8 71,249,361 (GRCm39) missense unknown
R9087:Mast3 UTSW 8 71,242,330 (GRCm39) missense possibly damaging 0.93
R9148:Mast3 UTSW 8 71,233,091 (GRCm39) missense probably damaging 0.98
R9364:Mast3 UTSW 8 71,238,826 (GRCm39) missense probably damaging 1.00
R9779:Mast3 UTSW 8 71,238,127 (GRCm39) missense probably damaging 1.00
Z1177:Mast3 UTSW 8 71,241,682 (GRCm39) critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- ACCACGTCCATGTGTACCAG -3'
(R):5'- AATGAGTGTTCTTCCCACCC -3'

Sequencing Primer
(F):5'- AGGACTGACTCCCCATTGATGTG -3'
(R):5'- TCTACAGACGACGGCAGC -3'
Posted On 2019-10-24