Incidental Mutation 'R7576:Tns3'
ID 586437
Institutional Source Beutler Lab
Gene Symbol Tns3
Ensembl Gene ENSMUSG00000020422
Gene Name tensin 3
Synonyms F830010I22Rik, Tens1, TEM6
MMRRC Submission 045661-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.327) question?
Stock # R7576 (G1)
Quality Score 225.009
Status Not validated
Chromosome 11
Chromosomal Location 8381652-8614681 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 8491192 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Methionine to Leucine at position 122 (M122L)
Ref Sequence ENSEMBL: ENSMUSP00000020695 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020695]
AlphaFold Q5SSZ5
Predicted Effect possibly damaging
Transcript: ENSMUST00000020695
AA Change: M122L

PolyPhen 2 Score 0.782 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000020695
Gene: ENSMUSG00000020422
AA Change: M122L

DomainStartEndE-ValueType
SCOP:d1d5ra2 1 171 5e-28 SMART
PTEN_C2 173 300 1.15e-48 SMART
low complexity region 854 864 N/A INTRINSIC
low complexity region 1102 1126 N/A INTRINSIC
SH2 1165 1268 1.32e-18 SMART
PTB 1301 1438 3.14e-24 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele exhibit one third postnatal lethality, reduced body weight, growth retardation, smaller digestive tracts with defects in villi and enterocyte differentiation, abnormal lung morphology, and thinner bones with decreased chondrocyte proliferation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ahdc1 A T 4: 132,792,313 (GRCm39) S1185C possibly damaging Het
Akap9 C G 5: 4,018,745 (GRCm39) H1109D probably benign Het
Alpk2 T C 18: 65,439,887 (GRCm39) D502G possibly damaging Het
Bcl2 A G 1: 106,640,153 (GRCm39) V153A possibly damaging Het
Brinp3 A T 1: 146,777,301 (GRCm39) S583C probably damaging Het
Calr4 A T 4: 109,096,161 (GRCm39) Q113L probably benign Het
Carm1 T G 9: 21,497,832 (GRCm39) probably null Het
Ccdc30 A G 4: 119,207,063 (GRCm39) L353P probably damaging Het
Ccdc91 C G 6: 147,491,957 (GRCm39) Q280E unknown Het
Cdk5rap2 T C 4: 70,185,109 (GRCm39) T1114A probably benign Het
Ciao3 A C 17: 25,997,944 (GRCm39) T154P probably damaging Het
Dync2i2 C T 2: 29,938,790 (GRCm39) R31Q probably benign Het
Enpep T A 3: 129,077,740 (GRCm39) T626S probably benign Het
Epcam T C 17: 87,947,721 (GRCm39) S64P probably damaging Het
Erc1 G T 6: 119,801,721 (GRCm39) P99T possibly damaging Het
Fastkd1 A G 2: 69,524,988 (GRCm39) L636S probably damaging Het
Fmn1 A G 2: 113,195,353 (GRCm39) D351G unknown Het
Fndc8 T G 11: 82,788,400 (GRCm39) S77A probably damaging Het
Gbp10 G A 5: 105,384,015 (GRCm39) probably benign Het
Gemin6 T A 17: 80,533,155 (GRCm39) Y29* probably null Het
Gja8 T C 3: 96,827,209 (GRCm39) E151G probably benign Het
Gje1 A G 10: 14,592,501 (GRCm39) Y94H probably damaging Het
Glt6d1 A G 2: 25,704,134 (GRCm39) F26S probably benign Het
Gltpd2 T A 11: 70,410,306 (GRCm39) probably null Het
Gm10153 A C 7: 141,743,859 (GRCm39) C70G unknown Het
Gm28729 G A 9: 96,376,410 (GRCm39) T368M probably damaging Het
Gm4559 A G 7: 141,827,677 (GRCm39) C142R unknown Het
Golm1 T C 13: 59,792,920 (GRCm39) N195S probably benign Het
Hectd4 A T 5: 121,487,522 (GRCm39) S3506C possibly damaging Het
Hnrnpll G A 17: 80,351,943 (GRCm39) S334L possibly damaging Het
Ighv7-3 A T 12: 114,116,865 (GRCm39) I99N possibly damaging Het
Igkv8-24 A G 6: 70,194,002 (GRCm39) S69P not run Het
Ilvbl A T 10: 78,419,531 (GRCm39) H537L possibly damaging Het
Lama1 G A 17: 68,089,036 (GRCm39) G1569D Het
Lin7b A T 7: 45,018,649 (GRCm39) Y118* probably null Het
Mansc1 T A 6: 134,587,674 (GRCm39) S168C possibly damaging Het
Mast3 A G 8: 71,233,838 (GRCm39) V969A probably damaging Het
Muc4 C T 16: 32,754,500 (GRCm38) T1458I probably benign Het
Myh10 A G 11: 68,692,992 (GRCm39) E1429G probably damaging Het
Neurod1 G T 2: 79,284,689 (GRCm39) Y231* probably null Het
Nrxn2 G T 19: 6,581,540 (GRCm39) E1492* probably null Het
Nwd2 A G 5: 63,964,736 (GRCm39) Q1440R probably benign Het
Or10j3b A G 1: 173,043,538 (GRCm39) T107A probably benign Het
Or6z7 T A 7: 6,483,330 (GRCm39) N275I probably damaging Het
Or8u3-ps A G 2: 85,952,720 (GRCm39) Y151C probably damaging Het
Pacs1 T A 19: 5,195,148 (GRCm39) T479S probably benign Het
Pds5b A G 5: 150,701,726 (GRCm39) K786E probably damaging Het
Pigp A G 16: 94,171,264 (GRCm39) L9P probably benign Het
Plec C T 15: 76,071,946 (GRCm39) R707Q unknown Het
Ppef2 T A 5: 92,400,993 (GRCm39) H9L possibly damaging Het
Ppid T A 3: 79,507,698 (GRCm39) C296S probably damaging Het
Ppp2r5b T G 19: 6,278,514 (GRCm39) E465A possibly damaging Het
Ppp4r4 A G 12: 103,562,708 (GRCm39) N559S probably damaging Het
Ptprt T C 2: 161,449,225 (GRCm39) T873A possibly damaging Het
Rbpms A G 8: 34,356,416 (GRCm39) V28A probably damaging Het
Retreg2 A G 1: 75,121,332 (GRCm39) M203V probably damaging Het
Rfx4 A G 10: 84,699,213 (GRCm39) E367G probably damaging Het
Robo1 C T 16: 72,767,069 (GRCm39) P414S probably damaging Het
Sac3d1 T A 19: 6,166,178 (GRCm39) E410D probably damaging Het
Scgb2b19 A T 7: 32,979,211 (GRCm39) C24S possibly damaging Het
She T C 3: 89,738,919 (GRCm39) F37L probably damaging Het
Slc5a2 G A 7: 127,864,977 (GRCm39) V37I probably damaging Het
Smyd4 T A 11: 75,281,032 (GRCm39) D168E probably benign Het
Ssc5d C A 7: 4,931,572 (GRCm39) P260T probably damaging Het
Steap2 A G 5: 5,727,406 (GRCm39) F310L probably benign Het
Tctn1 A T 5: 122,386,071 (GRCm39) I347N probably damaging Het
Tmtc2 A G 10: 105,206,482 (GRCm39) L271P probably damaging Het
Ubr7 T G 12: 102,735,398 (GRCm39) C286G probably damaging Het
Usp16 T C 16: 87,276,188 (GRCm39) S509P probably benign Het
Usp44 A G 10: 93,682,290 (GRCm39) T247A probably damaging Het
Vmn2r92 A C 17: 18,387,621 (GRCm39) M209L probably benign Het
Zc3h6 C T 2: 128,856,473 (GRCm39) P518S probably damaging Het
Zfp229 A G 17: 21,964,280 (GRCm39) H170R probably damaging Het
Zfp960 A G 17: 17,308,227 (GRCm39) T314A probably benign Het
Other mutations in Tns3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00163:Tns3 APN 11 8,401,066 (GRCm39) missense probably benign 0.42
IGL00822:Tns3 APN 11 8,393,976 (GRCm39) missense probably damaging 0.99
IGL01075:Tns3 APN 11 8,428,399 (GRCm39) missense probably benign 0.45
IGL01286:Tns3 APN 11 8,442,617 (GRCm39) missense probably benign 0.01
IGL01680:Tns3 APN 11 8,498,937 (GRCm39) missense probably damaging 1.00
IGL01687:Tns3 APN 11 8,442,798 (GRCm39) missense probably damaging 1.00
IGL01734:Tns3 APN 11 8,469,192 (GRCm39) splice site probably benign
IGL01844:Tns3 APN 11 8,387,177 (GRCm39) missense possibly damaging 0.58
IGL01984:Tns3 APN 11 8,498,992 (GRCm39) nonsense probably null
IGL02137:Tns3 APN 11 8,442,578 (GRCm39) missense possibly damaging 0.93
IGL02273:Tns3 APN 11 8,384,531 (GRCm39) missense probably damaging 1.00
IGL02623:Tns3 APN 11 8,387,141 (GRCm39) missense probably damaging 1.00
IGL02697:Tns3 APN 11 8,442,346 (GRCm39) missense probably benign 0.00
IGL02829:Tns3 APN 11 8,469,564 (GRCm39) missense probably damaging 1.00
ANU74:Tns3 UTSW 11 8,442,149 (GRCm39) missense probably benign 0.38
R0020:Tns3 UTSW 11 8,495,227 (GRCm39) critical splice donor site probably null
R0064:Tns3 UTSW 11 8,385,856 (GRCm39) nonsense probably null
R0064:Tns3 UTSW 11 8,385,856 (GRCm39) nonsense probably null
R0370:Tns3 UTSW 11 8,395,730 (GRCm39) missense possibly damaging 0.80
R0388:Tns3 UTSW 11 8,395,703 (GRCm39) missense probably benign 0.07
R0410:Tns3 UTSW 11 8,385,852 (GRCm39) missense probably benign 0.02
R0496:Tns3 UTSW 11 8,497,262 (GRCm39) splice site probably benign
R0562:Tns3 UTSW 11 8,443,262 (GRCm39) missense possibly damaging 0.93
R0626:Tns3 UTSW 11 8,443,121 (GRCm39) missense probably benign 0.04
R0736:Tns3 UTSW 11 8,469,474 (GRCm39) missense possibly damaging 0.94
R0893:Tns3 UTSW 11 8,443,302 (GRCm39) missense probably damaging 1.00
R1367:Tns3 UTSW 11 8,398,704 (GRCm39) missense probably benign 0.01
R1386:Tns3 UTSW 11 8,468,261 (GRCm39) missense probably benign 0.02
R1975:Tns3 UTSW 11 8,385,738 (GRCm39) missense probably benign 0.04
R2205:Tns3 UTSW 11 8,481,719 (GRCm39) missense probably damaging 1.00
R2319:Tns3 UTSW 11 8,491,200 (GRCm39) missense probably damaging 1.00
R2830:Tns3 UTSW 11 8,385,870 (GRCm39) missense probably damaging 1.00
R3720:Tns3 UTSW 11 8,442,999 (GRCm39) missense probably damaging 1.00
R3765:Tns3 UTSW 11 8,401,133 (GRCm39) missense probably benign 0.00
R3817:Tns3 UTSW 11 8,384,619 (GRCm39) missense probably damaging 1.00
R4058:Tns3 UTSW 11 8,442,275 (GRCm39) missense probably damaging 1.00
R4599:Tns3 UTSW 11 8,481,747 (GRCm39) missense probably damaging 1.00
R4631:Tns3 UTSW 11 8,401,119 (GRCm39) missense probably benign 0.30
R4731:Tns3 UTSW 11 8,400,986 (GRCm39) missense probably benign 0.28
R4732:Tns3 UTSW 11 8,400,986 (GRCm39) missense probably benign 0.28
R4733:Tns3 UTSW 11 8,400,986 (GRCm39) missense probably benign 0.28
R5472:Tns3 UTSW 11 8,401,092 (GRCm39) missense probably benign
R5749:Tns3 UTSW 11 8,401,177 (GRCm39) missense probably benign 0.01
R5807:Tns3 UTSW 11 8,443,211 (GRCm39) missense probably damaging 1.00
R5844:Tns3 UTSW 11 8,384,580 (GRCm39) missense probably damaging 1.00
R5942:Tns3 UTSW 11 8,385,860 (GRCm39) missense probably damaging 1.00
R5982:Tns3 UTSW 11 8,442,245 (GRCm39) missense probably damaging 0.99
R6025:Tns3 UTSW 11 8,442,578 (GRCm39) missense possibly damaging 0.93
R6266:Tns3 UTSW 11 8,442,987 (GRCm39) missense probably damaging 1.00
R6322:Tns3 UTSW 11 8,442,147 (GRCm39) missense probably benign 0.01
R6536:Tns3 UTSW 11 8,384,531 (GRCm39) missense probably damaging 1.00
R6577:Tns3 UTSW 11 8,499,058 (GRCm39) missense probably damaging 1.00
R6577:Tns3 UTSW 11 8,499,057 (GRCm39) missense probably damaging 1.00
R6864:Tns3 UTSW 11 8,443,196 (GRCm39) missense probably damaging 1.00
R6897:Tns3 UTSW 11 8,481,743 (GRCm39) missense probably damaging 1.00
R7108:Tns3 UTSW 11 8,387,251 (GRCm39) missense probably benign 0.00
R7443:Tns3 UTSW 11 8,401,442 (GRCm39) missense probably benign 0.01
R7459:Tns3 UTSW 11 8,442,793 (GRCm39) missense probably benign 0.16
R7474:Tns3 UTSW 11 8,480,894 (GRCm39) missense probably damaging 1.00
R7979:Tns3 UTSW 11 8,442,701 (GRCm39) missense probably benign 0.01
R8055:Tns3 UTSW 11 8,495,343 (GRCm39) missense probably damaging 1.00
R8057:Tns3 UTSW 11 8,442,773 (GRCm39) missense probably benign
R8077:Tns3 UTSW 11 8,395,667 (GRCm39) missense probably damaging 1.00
R8518:Tns3 UTSW 11 8,442,971 (GRCm39) missense probably damaging 0.96
R8523:Tns3 UTSW 11 8,398,779 (GRCm39) missense probably damaging 1.00
R8790:Tns3 UTSW 11 8,468,273 (GRCm39) missense probably damaging 0.99
R9228:Tns3 UTSW 11 8,400,094 (GRCm39) missense probably damaging 1.00
R9374:Tns3 UTSW 11 8,442,606 (GRCm39) missense probably damaging 1.00
R9476:Tns3 UTSW 11 8,395,702 (GRCm39) missense probably damaging 0.99
R9510:Tns3 UTSW 11 8,395,702 (GRCm39) missense probably damaging 0.99
R9594:Tns3 UTSW 11 8,401,142 (GRCm39) missense possibly damaging 0.79
R9595:Tns3 UTSW 11 8,401,142 (GRCm39) missense possibly damaging 0.79
R9596:Tns3 UTSW 11 8,401,142 (GRCm39) missense possibly damaging 0.79
R9624:Tns3 UTSW 11 8,401,142 (GRCm39) missense possibly damaging 0.79
R9629:Tns3 UTSW 11 8,401,142 (GRCm39) missense possibly damaging 0.79
T0975:Tns3 UTSW 11 8,401,146 (GRCm39) missense probably benign 0.00
T0975:Tns3 UTSW 11 8,499,100 (GRCm39) start gained probably benign
T0975:Tns3 UTSW 11 8,429,518 (GRCm39) missense probably benign
X0005:Tns3 UTSW 11 8,429,518 (GRCm39) missense probably benign
X0005:Tns3 UTSW 11 8,401,224 (GRCm39) missense probably benign 0.00
Z1177:Tns3 UTSW 11 8,401,014 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- TGCTTGCCTCCATAGAGCTC -3'
(R):5'- GCTCTAATGTTAGGGAGGCAG -3'

Sequencing Primer
(F):5'- CATAGAGCTCCTGGGAATCAGTC -3'
(R):5'- CAGAGGGGTTAATACTTGTTCTCTGC -3'
Posted On 2019-10-24