Incidental Mutation 'R7576:Pigp'
ID586450
Institutional Source Beutler Lab
Gene Symbol Pigp
Ensembl Gene ENSMUSG00000022940
Gene Namephosphatidylinositol glycan anchor biosynthesis, class P
SynonymsDcrc, Dscr5
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.547) question?
Stock #R7576 (G1)
Quality Score204.009
Status Not validated
Chromosome16
Chromosomal Location94358763-94371842 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 94370405 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 9 (L9P)
Ref Sequence ENSEMBL: ENSMUSP00000109543 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000113905] [ENSMUST00000113906] [ENSMUST00000113910] [ENSMUST00000113914] [ENSMUST00000113917] [ENSMUST00000117648] [ENSMUST00000119131] [ENSMUST00000122895] [ENSMUST00000138514] [ENSMUST00000139513] [ENSMUST00000141856] [ENSMUST00000143145] [ENSMUST00000145432] [ENSMUST00000145883] [ENSMUST00000147046] [ENSMUST00000147352] [ENSMUST00000149885] [ENSMUST00000150097] [ENSMUST00000150346] [ENSMUST00000151770] [ENSMUST00000152117] [ENSMUST00000153062] [ENSMUST00000153988] [ENSMUST00000154243] [ENSMUST00000155692] [ENSMUST00000231569] [ENSMUST00000232294]
Predicted Effect probably benign
Transcript: ENSMUST00000113905
SMART Domains Protein: ENSMUSP00000109538
Gene: ENSMUSG00000022940

DomainStartEndE-ValueType
Pfam:PIG-P 10 125 7.6e-45 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113906
SMART Domains Protein: ENSMUSP00000109539
Gene: ENSMUSG00000022940

DomainStartEndE-ValueType
Pfam:PIG-P 10 125 7.6e-45 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113910
AA Change: L9P

PolyPhen 2 Score 0.399 (Sensitivity: 0.89; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000109543
Gene: ENSMUSG00000022940
AA Change: L9P

DomainStartEndE-ValueType
Pfam:PIG-P 39 154 1.5e-44 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113914
SMART Domains Protein: ENSMUSP00000109547
Gene: ENSMUSG00000022940

DomainStartEndE-ValueType
low complexity region 11 19 N/A INTRINSIC
Pfam:PIG-P 84 197 1e-43 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113917
SMART Domains Protein: ENSMUSP00000109550
Gene: ENSMUSG00000022940

DomainStartEndE-ValueType
Pfam:PIG-P 43 135 5.6e-36 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000117648
SMART Domains Protein: ENSMUSP00000112801
Gene: ENSMUSG00000040785

DomainStartEndE-ValueType
TPR 231 264 3.61e-2 SMART
TPR 265 298 3.32e-1 SMART
Blast:TPR 300 332 2e-12 BLAST
low complexity region 444 459 N/A INTRINSIC
TPR 576 609 2.55e-2 SMART
low complexity region 720 732 N/A INTRINSIC
coiled coil region 765 796 N/A INTRINSIC
low complexity region 1018 1032 N/A INTRINSIC
low complexity region 1036 1050 N/A INTRINSIC
low complexity region 1170 1190 N/A INTRINSIC
low complexity region 1248 1260 N/A INTRINSIC
low complexity region 1278 1291 N/A INTRINSIC
coiled coil region 1472 1570 N/A INTRINSIC
low complexity region 1876 1887 N/A INTRINSIC
RING 1931 1970 7e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000119131
SMART Domains Protein: ENSMUSP00000113311
Gene: ENSMUSG00000040785

DomainStartEndE-ValueType
Pfam:TPR_11 229 285 1.1e-12 PFAM
Pfam:TPR_1 232 264 2.1e-4 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000122895
SMART Domains Protein: ENSMUSP00000123037
Gene: ENSMUSG00000040785

DomainStartEndE-ValueType
TPR 213 246 3.61e-2 SMART
TPR 247 280 3.32e-1 SMART
Blast:TPR 282 314 3e-12 BLAST
low complexity region 426 441 N/A INTRINSIC
TPR 558 591 2.55e-2 SMART
low complexity region 702 714 N/A INTRINSIC
coiled coil region 747 778 N/A INTRINSIC
low complexity region 1000 1014 N/A INTRINSIC
low complexity region 1018 1032 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000127667
SMART Domains Protein: ENSMUSP00000122425
Gene: ENSMUSG00000040785

DomainStartEndE-ValueType
Pfam:TPR_11 22 89 4.7e-16 PFAM
Pfam:TPR_2 24 57 5.7e-4 PFAM
Pfam:TPR_1 25 57 3.5e-5 PFAM
Pfam:TPR_9 35 103 3.2e-6 PFAM
Pfam:TPR_1 58 89 2.1e-4 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000138514
SMART Domains Protein: ENSMUSP00000114477
Gene: ENSMUSG00000022940

DomainStartEndE-ValueType
Pfam:PIG-P 43 152 1.2e-42 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000139513
SMART Domains Protein: ENSMUSP00000117881
Gene: ENSMUSG00000040785

DomainStartEndE-ValueType
low complexity region 8 22 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000141856
SMART Domains Protein: ENSMUSP00000117369
Gene: ENSMUSG00000040785

DomainStartEndE-ValueType
Pfam:TPR_1 90 121 1e-6 PFAM
Pfam:TPR_2 90 121 7.9e-6 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000143145
Predicted Effect probably benign
Transcript: ENSMUST00000145432
Predicted Effect probably benign
Transcript: ENSMUST00000145883
SMART Domains Protein: ENSMUSP00000123442
Gene: ENSMUSG00000040785

DomainStartEndE-ValueType
transmembrane domain 42 64 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000147046
SMART Domains Protein: ENSMUSP00000119265
Gene: ENSMUSG00000040785

DomainStartEndE-ValueType
low complexity region 43 58 N/A INTRINSIC
Pfam:TPR_1 175 206 5.3e-6 PFAM
low complexity region 319 331 N/A INTRINSIC
low complexity region 359 382 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000147352
SMART Domains Protein: ENSMUSP00000116097
Gene: ENSMUSG00000040785

DomainStartEndE-ValueType
TPR 213 246 3.61e-2 SMART
TPR 247 280 3.32e-1 SMART
Blast:TPR 282 314 3e-12 BLAST
low complexity region 426 441 N/A INTRINSIC
TPR 558 591 2.55e-2 SMART
low complexity region 702 714 N/A INTRINSIC
coiled coil region 747 778 N/A INTRINSIC
low complexity region 1000 1014 N/A INTRINSIC
low complexity region 1018 1032 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000149885
SMART Domains Protein: ENSMUSP00000122006
Gene: ENSMUSG00000040785

DomainStartEndE-ValueType
Pfam:TPR_2 1 31 3.5e-4 PFAM
Pfam:TPR_11 1 58 7.8e-16 PFAM
Pfam:TPR_1 2 31 1.8e-5 PFAM
Pfam:TPR_9 9 58 2.5e-6 PFAM
Pfam:TPR_17 20 53 4.2e-7 PFAM
Pfam:TPR_1 32 58 2.5e-4 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000150097
SMART Domains Protein: ENSMUSP00000119035
Gene: ENSMUSG00000040785

DomainStartEndE-ValueType
Blast:TPR 1 22 1e-6 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000150346
SMART Domains Protein: ENSMUSP00000122726
Gene: ENSMUSG00000040785

DomainStartEndE-ValueType
low complexity region 43 58 N/A INTRINSIC
Pfam:TPR_1 175 206 9.6e-6 PFAM
low complexity region 319 331 N/A INTRINSIC
coiled coil region 364 395 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000151770
SMART Domains Protein: ENSMUSP00000121349
Gene: ENSMUSG00000040785

DomainStartEndE-ValueType
TPR 231 264 3.61e-2 SMART
TPR 265 298 3.32e-1 SMART
Blast:TPR 300 332 3e-12 BLAST
low complexity region 444 459 N/A INTRINSIC
TPR 576 609 2.55e-2 SMART
low complexity region 720 732 N/A INTRINSIC
coiled coil region 765 796 N/A INTRINSIC
low complexity region 1018 1032 N/A INTRINSIC
low complexity region 1036 1050 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000152117
SMART Domains Protein: ENSMUSP00000116896
Gene: ENSMUSG00000040785

DomainStartEndE-ValueType
low complexity region 43 58 N/A INTRINSIC
SCOP:d1ihga1 69 201 6e-8 SMART
Blast:TPR 175 208 1e-14 BLAST
low complexity region 319 331 N/A INTRINSIC
coiled coil region 364 395 N/A INTRINSIC
low complexity region 617 631 N/A INTRINSIC
low complexity region 635 649 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000153062
Predicted Effect probably benign
Transcript: ENSMUST00000153988
SMART Domains Protein: ENSMUSP00000118763
Gene: ENSMUSG00000040785

DomainStartEndE-ValueType
Blast:TPR 1 22 3e-6 BLAST
low complexity region 134 149 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000154243
Predicted Effect probably benign
Transcript: ENSMUST00000155692
SMART Domains Protein: ENSMUSP00000122724
Gene: ENSMUSG00000040785

DomainStartEndE-ValueType
TPR 250 283 3.61e-2 SMART
TPR 284 317 3.32e-1 SMART
Blast:TPR 319 351 3e-12 BLAST
low complexity region 463 478 N/A INTRINSIC
TPR 595 628 2.55e-2 SMART
low complexity region 739 751 N/A INTRINSIC
coiled coil region 784 815 N/A INTRINSIC
low complexity region 1037 1051 N/A INTRINSIC
low complexity region 1055 1069 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000231569
Predicted Effect probably benign
Transcript: ENSMUST00000232294
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an enzyme involved in the first step of glycosylphosphatidylinositol (GPI)-anchor biosynthesis. The GPI-anchor is a glycolipid found on many blood cells that serves to anchor proteins to the cell surface. The encoded protein is a component of the GPI-N-acetylglucosaminyltransferase complex that catalyzes the transfer of N-acetylglucosamine (GlcNAc) from UDP-GlcNAc to phosphatidylinositol (PI). This gene is located in the Down Syndrome critical region on chromosome 21 and is a candidate for the pathogenesis of Down syndrome. This gene has multiple pseudogenes and is a member of the phosphatidylinositol glycan anchor biosynthesis gene family. Alternatively spliced transcript variants encoding different isoforms have been described. [provided by RefSeq, Feb 2016]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ahdc1 A T 4: 133,065,002 S1185C possibly damaging Het
Akap9 C G 5: 3,968,745 H1109D probably benign Het
Alpk2 T C 18: 65,306,816 D502G possibly damaging Het
Bcl2 A G 1: 106,712,423 V153A possibly damaging Het
Brinp3 A T 1: 146,901,563 S583C probably damaging Het
Calr4 A T 4: 109,238,964 Q113L probably benign Het
Carm1 T G 9: 21,586,536 probably null Het
Ccdc30 A G 4: 119,349,866 L353P probably damaging Het
Ccdc91 C G 6: 147,590,459 Q280E unknown Het
Cdk5rap2 T C 4: 70,266,872 T1114A probably benign Het
Enpep T A 3: 129,284,091 T626S probably benign Het
Epcam T C 17: 87,640,293 S64P probably damaging Het
Erc1 G T 6: 119,824,760 P99T possibly damaging Het
Fastkd1 A G 2: 69,694,644 L636S probably damaging Het
Fmn1 A G 2: 113,365,008 D351G unknown Het
Fndc8 T G 11: 82,897,574 S77A probably damaging Het
Gbp10 G A 5: 105,236,149 probably benign Het
Gemin6 T A 17: 80,225,726 Y29* probably null Het
Gja8 T C 3: 96,919,893 E151G probably benign Het
Gje1 A G 10: 14,716,757 Y94H probably damaging Het
Glt6d1 A G 2: 25,814,122 F26S probably benign Het
Gltpd2 T A 11: 70,519,480 probably null Het
Gm10153 A C 7: 142,190,122 C70G unknown Het
Gm28729 G A 9: 96,494,357 T368M probably damaging Het
Gm4559 A G 7: 142,273,940 C142R unknown Het
Golm1 T C 13: 59,645,106 N195S probably benign Het
Hectd4 A T 5: 121,349,459 S3506C possibly damaging Het
Hnrnpll G A 17: 80,044,514 S334L possibly damaging Het
Ighv7-3 A T 12: 114,153,245 I99N possibly damaging Het
Igkv8-24 A G 6: 70,217,018 S69P not run Het
Ilvbl A T 10: 78,583,697 H537L possibly damaging Het
Lama1 G A 17: 67,782,041 G1569D Het
Lin7b A T 7: 45,369,225 Y118* probably null Het
Mansc1 T A 6: 134,610,711 S168C possibly damaging Het
Mast3 A G 8: 70,781,194 V969A probably damaging Het
Muc4 C T 16: 32,754,500 T1458I probably benign Het
Myh10 A G 11: 68,802,166 E1429G probably damaging Het
Narfl A C 17: 25,778,970 T154P probably damaging Het
Neurod1 G T 2: 79,454,345 Y231* probably null Het
Nrxn2 G T 19: 6,531,510 E1492* probably null Het
Nwd2 A G 5: 63,807,393 Q1440R probably benign Het
Olfr1038-ps A G 2: 86,122,376 Y151C probably damaging Het
Olfr1404 A G 1: 173,215,971 T107A probably benign Het
Olfr5 T A 7: 6,480,331 N275I probably damaging Het
Pacs1 T A 19: 5,145,120 T479S probably benign Het
Pds5b A G 5: 150,778,261 K786E probably damaging Het
Plec C T 15: 76,187,746 R707Q unknown Het
Ppef2 T A 5: 92,253,134 H9L possibly damaging Het
Ppid T A 3: 79,600,391 C296S probably damaging Het
Ppp2r5b T G 19: 6,228,484 E465A possibly damaging Het
Ppp4r4 A G 12: 103,596,449 N559S probably damaging Het
Ptprt T C 2: 161,607,305 T873A possibly damaging Het
Rbpms A G 8: 33,866,388 V28A probably damaging Het
Retreg2 A G 1: 75,144,688 M203V probably damaging Het
Rfx4 A G 10: 84,863,349 E367G probably damaging Het
Robo1 C T 16: 72,970,181 P414S probably damaging Het
Sac3d1 T A 19: 6,116,148 E410D probably damaging Het
Scgb2b19 A T 7: 33,279,786 C24S possibly damaging Het
She T C 3: 89,831,612 F37L probably damaging Het
Slc5a2 G A 7: 128,265,805 V37I probably damaging Het
Smyd4 T A 11: 75,390,206 D168E probably benign Het
Ssc5d C A 7: 4,928,573 P260T probably damaging Het
Steap2 A G 5: 5,677,406 F310L probably benign Het
Tctn1 A T 5: 122,248,008 I347N probably damaging Het
Tmtc2 A G 10: 105,370,621 L271P probably damaging Het
Tns3 T A 11: 8,541,192 M122L possibly damaging Het
Ubr7 T G 12: 102,769,139 C286G probably damaging Het
Usp16 T C 16: 87,479,300 S509P probably benign Het
Usp44 A G 10: 93,846,428 T247A probably damaging Het
Vmn2r92 A C 17: 18,167,359 M209L probably benign Het
Wdr34 C T 2: 30,048,778 R31Q probably benign Het
Zc3h6 C T 2: 129,014,553 P518S probably damaging Het
Zfp229 A G 17: 21,745,299 H170R probably damaging Het
Zfp960 A G 17: 17,087,965 T314A probably benign Het
Other mutations in Pigp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02100:Pigp APN 16 94364767 nonsense probably null
IGL02728:Pigp APN 16 94367607 missense probably damaging 1.00
schweinchen UTSW 16 94365441 missense probably damaging 1.00
R0092:Pigp UTSW 16 94365462 missense probably damaging 0.96
R3614:Pigp UTSW 16 94364724 missense possibly damaging 0.91
R4872:Pigp UTSW 16 94365450 missense probably benign 0.18
R4959:Pigp UTSW 16 94359147 missense probably benign 0.00
R4973:Pigp UTSW 16 94359147 missense probably benign 0.00
R5970:Pigp UTSW 16 94370194 critical splice acceptor site probably null
R6135:Pigp UTSW 16 94370206 missense probably benign 0.20
R6179:Pigp UTSW 16 94370367 missense probably null 0.99
R6732:Pigp UTSW 16 94365441 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGAACACAATCGTCGTCAGAC -3'
(R):5'- TGGTGAGACCGTGCTAGC -3'

Sequencing Primer
(F):5'- GTCGTCAGACATCTCCCCC -3'
(R):5'- AATTTCCGCCCACGCTG -3'
Posted On2019-10-24