Incidental Mutation 'R7576:Lama1'
ID 586455
Institutional Source Beutler Lab
Gene Symbol Lama1
Ensembl Gene ENSMUSG00000032796
Gene Name laminin, alpha 1
Synonyms Lama
MMRRC Submission 045661-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R7576 (G1)
Quality Score 225.009
Status Not validated
Chromosome 17
Chromosomal Location 68004254-68129642 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 68089036 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glycine to Aspartic acid at position 1569 (G1569D)
Ref Sequence ENSEMBL: ENSMUSP00000043957 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035471]
AlphaFold no structure available at present
Predicted Effect
SMART Domains Protein: ENSMUSP00000043957
Gene: ENSMUSG00000032796
AA Change: G1569D

DomainStartEndE-ValueType
low complexity region 3 22 N/A INTRINSIC
LamNT 23 275 1.2e-131 SMART
EGF_Lam 277 331 1e-5 SMART
EGF_Lam 334 401 6.6e-6 SMART
EGF_Lam 404 458 9.11e-9 SMART
EGF_Lam 461 507 8.12e-6 SMART
LamB 570 702 2.09e-57 SMART
EGF_like 715 746 3.36e0 SMART
EGF_Lam 749 795 7.01e-10 SMART
EGF_Lam 798 853 3.59e-7 SMART
EGF_Lam 856 906 1.53e-10 SMART
EGF_Lam 909 955 1.13e-13 SMART
EGF_Lam 958 1002 1.36e-7 SMART
EGF_Lam 1005 1048 7.29e-8 SMART
EGF_like 1034 1082 4.83e1 SMART
EGF_Lam 1051 1094 1.67e-7 SMART
EGF_Lam 1097 1154 1.32e-5 SMART
LamB 1220 1352 8.7e-46 SMART
Pfam:Laminin_EGF 1367 1397 1.7e-6 PFAM
EGF_Lam 1410 1456 7.12e-11 SMART
EGF_Lam 1459 1513 3.25e-5 SMART
EGF_like 1497 1547 6.41e1 SMART
EGF_Lam 1516 1560 1.71e-13 SMART
Pfam:Laminin_I 1574 1838 1.7e-91 PFAM
low complexity region 2012 2031 N/A INTRINSIC
low complexity region 2087 2098 N/A INTRINSIC
LamG 2145 2287 3.66e-30 SMART
LamG 2332 2473 5.98e-35 SMART
LamG 2513 2661 1.11e-29 SMART
low complexity region 2695 2708 N/A INTRINSIC
LamG 2743 2877 9.72e-35 SMART
LamG 2920 3056 4.63e-41 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of the alpha 1 subunits of laminin. The laminins are a family of extracellular matrix glycoproteins that have a heterotrimeric structure consisting of an alpha, beta and gamma chain. These proteins make up a major component of the basement membrane and have been implicated in a wide variety of biological processes including cell adhesion, differentiation, migration, signaling, neurite outgrowth and metastasis. Mutations in this gene may be associated with Poretti-Boltshauser syndrome. [provided by RefSeq, Sep 2014]
PHENOTYPE: Homozygous null mice display embryonic lethality before somite formation with impaired formation of Reichert's membrane. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ahdc1 A T 4: 132,792,313 (GRCm39) S1185C possibly damaging Het
Akap9 C G 5: 4,018,745 (GRCm39) H1109D probably benign Het
Alpk2 T C 18: 65,439,887 (GRCm39) D502G possibly damaging Het
Bcl2 A G 1: 106,640,153 (GRCm39) V153A possibly damaging Het
Brinp3 A T 1: 146,777,301 (GRCm39) S583C probably damaging Het
Calr4 A T 4: 109,096,161 (GRCm39) Q113L probably benign Het
Carm1 T G 9: 21,497,832 (GRCm39) probably null Het
Ccdc30 A G 4: 119,207,063 (GRCm39) L353P probably damaging Het
Ccdc91 C G 6: 147,491,957 (GRCm39) Q280E unknown Het
Cdk5rap2 T C 4: 70,185,109 (GRCm39) T1114A probably benign Het
Ciao3 A C 17: 25,997,944 (GRCm39) T154P probably damaging Het
Dync2i2 C T 2: 29,938,790 (GRCm39) R31Q probably benign Het
Enpep T A 3: 129,077,740 (GRCm39) T626S probably benign Het
Epcam T C 17: 87,947,721 (GRCm39) S64P probably damaging Het
Erc1 G T 6: 119,801,721 (GRCm39) P99T possibly damaging Het
Fastkd1 A G 2: 69,524,988 (GRCm39) L636S probably damaging Het
Fmn1 A G 2: 113,195,353 (GRCm39) D351G unknown Het
Fndc8 T G 11: 82,788,400 (GRCm39) S77A probably damaging Het
Gbp10 G A 5: 105,384,015 (GRCm39) probably benign Het
Gemin6 T A 17: 80,533,155 (GRCm39) Y29* probably null Het
Gja8 T C 3: 96,827,209 (GRCm39) E151G probably benign Het
Gje1 A G 10: 14,592,501 (GRCm39) Y94H probably damaging Het
Glt6d1 A G 2: 25,704,134 (GRCm39) F26S probably benign Het
Gltpd2 T A 11: 70,410,306 (GRCm39) probably null Het
Gm10153 A C 7: 141,743,859 (GRCm39) C70G unknown Het
Gm28729 G A 9: 96,376,410 (GRCm39) T368M probably damaging Het
Gm4559 A G 7: 141,827,677 (GRCm39) C142R unknown Het
Golm1 T C 13: 59,792,920 (GRCm39) N195S probably benign Het
Hectd4 A T 5: 121,487,522 (GRCm39) S3506C possibly damaging Het
Hnrnpll G A 17: 80,351,943 (GRCm39) S334L possibly damaging Het
Ighv7-3 A T 12: 114,116,865 (GRCm39) I99N possibly damaging Het
Igkv8-24 A G 6: 70,194,002 (GRCm39) S69P not run Het
Ilvbl A T 10: 78,419,531 (GRCm39) H537L possibly damaging Het
Lin7b A T 7: 45,018,649 (GRCm39) Y118* probably null Het
Mansc1 T A 6: 134,587,674 (GRCm39) S168C possibly damaging Het
Mast3 A G 8: 71,233,838 (GRCm39) V969A probably damaging Het
Muc4 C T 16: 32,754,500 (GRCm38) T1458I probably benign Het
Myh10 A G 11: 68,692,992 (GRCm39) E1429G probably damaging Het
Neurod1 G T 2: 79,284,689 (GRCm39) Y231* probably null Het
Nrxn2 G T 19: 6,581,540 (GRCm39) E1492* probably null Het
Nwd2 A G 5: 63,964,736 (GRCm39) Q1440R probably benign Het
Or10j3b A G 1: 173,043,538 (GRCm39) T107A probably benign Het
Or6z7 T A 7: 6,483,330 (GRCm39) N275I probably damaging Het
Or8u3-ps A G 2: 85,952,720 (GRCm39) Y151C probably damaging Het
Pacs1 T A 19: 5,195,148 (GRCm39) T479S probably benign Het
Pds5b A G 5: 150,701,726 (GRCm39) K786E probably damaging Het
Pigp A G 16: 94,171,264 (GRCm39) L9P probably benign Het
Plec C T 15: 76,071,946 (GRCm39) R707Q unknown Het
Ppef2 T A 5: 92,400,993 (GRCm39) H9L possibly damaging Het
Ppid T A 3: 79,507,698 (GRCm39) C296S probably damaging Het
Ppp2r5b T G 19: 6,278,514 (GRCm39) E465A possibly damaging Het
Ppp4r4 A G 12: 103,562,708 (GRCm39) N559S probably damaging Het
Ptprt T C 2: 161,449,225 (GRCm39) T873A possibly damaging Het
Rbpms A G 8: 34,356,416 (GRCm39) V28A probably damaging Het
Retreg2 A G 1: 75,121,332 (GRCm39) M203V probably damaging Het
Rfx4 A G 10: 84,699,213 (GRCm39) E367G probably damaging Het
Robo1 C T 16: 72,767,069 (GRCm39) P414S probably damaging Het
Sac3d1 T A 19: 6,166,178 (GRCm39) E410D probably damaging Het
Scgb2b19 A T 7: 32,979,211 (GRCm39) C24S possibly damaging Het
She T C 3: 89,738,919 (GRCm39) F37L probably damaging Het
Slc5a2 G A 7: 127,864,977 (GRCm39) V37I probably damaging Het
Smyd4 T A 11: 75,281,032 (GRCm39) D168E probably benign Het
Ssc5d C A 7: 4,931,572 (GRCm39) P260T probably damaging Het
Steap2 A G 5: 5,727,406 (GRCm39) F310L probably benign Het
Tctn1 A T 5: 122,386,071 (GRCm39) I347N probably damaging Het
Tmtc2 A G 10: 105,206,482 (GRCm39) L271P probably damaging Het
Tns3 T A 11: 8,491,192 (GRCm39) M122L possibly damaging Het
Ubr7 T G 12: 102,735,398 (GRCm39) C286G probably damaging Het
Usp16 T C 16: 87,276,188 (GRCm39) S509P probably benign Het
Usp44 A G 10: 93,682,290 (GRCm39) T247A probably damaging Het
Vmn2r92 A C 17: 18,387,621 (GRCm39) M209L probably benign Het
Zc3h6 C T 2: 128,856,473 (GRCm39) P518S probably damaging Het
Zfp229 A G 17: 21,964,280 (GRCm39) H170R probably damaging Het
Zfp960 A G 17: 17,308,227 (GRCm39) T314A probably benign Het
Other mutations in Lama1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00157:Lama1 APN 17 68,122,923 (GRCm39) missense probably benign
IGL00336:Lama1 APN 17 68,120,943 (GRCm39) missense probably benign 0.07
IGL01066:Lama1 APN 17 68,050,321 (GRCm39) missense probably damaging 1.00
IGL01140:Lama1 APN 17 68,109,928 (GRCm39) missense probably benign 0.14
IGL01291:Lama1 APN 17 68,045,865 (GRCm39) missense probably damaging 1.00
IGL01296:Lama1 APN 17 68,052,046 (GRCm39) missense probably benign 0.27
IGL01317:Lama1 APN 17 68,125,696 (GRCm39) missense probably damaging 1.00
IGL01490:Lama1 APN 17 68,057,579 (GRCm39) missense possibly damaging 0.54
IGL01506:Lama1 APN 17 68,092,065 (GRCm39) missense probably benign 0.01
IGL01508:Lama1 APN 17 68,116,356 (GRCm39) splice site probably benign
IGL01522:Lama1 APN 17 68,059,769 (GRCm39) splice site probably benign
IGL01530:Lama1 APN 17 68,103,785 (GRCm39) missense probably benign 0.02
IGL01541:Lama1 APN 17 68,092,065 (GRCm39) missense probably benign 0.01
IGL01677:Lama1 APN 17 68,086,143 (GRCm39) missense probably benign 0.15
IGL01886:Lama1 APN 17 68,114,792 (GRCm39) missense probably benign 0.36
IGL01994:Lama1 APN 17 68,059,434 (GRCm39) missense probably benign 0.05
IGL02017:Lama1 APN 17 68,071,720 (GRCm39) missense probably benign 0.00
IGL02021:Lama1 APN 17 68,128,621 (GRCm39) missense probably damaging 1.00
IGL02026:Lama1 APN 17 68,116,287 (GRCm39) missense possibly damaging 0.82
IGL02044:Lama1 APN 17 68,118,485 (GRCm39) missense probably benign 0.01
IGL02120:Lama1 APN 17 68,023,784 (GRCm39) missense probably damaging 1.00
IGL02425:Lama1 APN 17 68,118,480 (GRCm39) missense probably benign 0.45
IGL02549:Lama1 APN 17 68,097,830 (GRCm39) missense possibly damaging 0.93
IGL02642:Lama1 APN 17 68,119,361 (GRCm39) missense probably benign 0.00
IGL02795:Lama1 APN 17 68,045,889 (GRCm39) splice site probably null
IGL02798:Lama1 APN 17 68,102,186 (GRCm39) splice site probably benign
IGL02863:Lama1 APN 17 68,111,531 (GRCm39) missense probably damaging 0.99
IGL02870:Lama1 APN 17 68,111,531 (GRCm39) missense probably damaging 0.99
IGL02876:Lama1 APN 17 68,057,687 (GRCm39) critical splice donor site probably null
IGL02885:Lama1 APN 17 68,111,531 (GRCm39) missense probably damaging 0.99
IGL02891:Lama1 APN 17 68,111,531 (GRCm39) missense probably damaging 0.99
IGL02978:Lama1 APN 17 68,093,076 (GRCm39) nonsense probably null
IGL03064:Lama1 APN 17 68,086,099 (GRCm39) missense probably benign 0.01
IGL03076:Lama1 APN 17 68,023,794 (GRCm39) missense possibly damaging 0.95
IGL03110:Lama1 APN 17 68,105,981 (GRCm39) missense probably benign 0.04
IGL03143:Lama1 APN 17 68,111,531 (GRCm39) missense probably damaging 0.99
IGL03159:Lama1 APN 17 68,111,531 (GRCm39) missense probably damaging 0.99
IGL03268:Lama1 APN 17 68,111,531 (GRCm39) missense probably damaging 0.99
ANU05:Lama1 UTSW 17 68,045,865 (GRCm39) missense probably damaging 1.00
PIT4472001:Lama1 UTSW 17 68,071,699 (GRCm39) missense
R0047:Lama1 UTSW 17 68,102,181 (GRCm39) splice site probably benign
R0047:Lama1 UTSW 17 68,102,181 (GRCm39) splice site probably benign
R0050:Lama1 UTSW 17 68,089,051 (GRCm39) missense possibly damaging 0.66
R0096:Lama1 UTSW 17 68,112,408 (GRCm39) missense probably benign 0.12
R0096:Lama1 UTSW 17 68,112,408 (GRCm39) missense probably benign 0.12
R0111:Lama1 UTSW 17 68,044,493 (GRCm39) missense probably damaging 0.98
R0116:Lama1 UTSW 17 68,083,918 (GRCm39) missense probably benign 0.10
R0121:Lama1 UTSW 17 68,105,508 (GRCm39) splice site probably benign
R0278:Lama1 UTSW 17 68,117,178 (GRCm39) missense probably null 0.98
R0281:Lama1 UTSW 17 68,124,564 (GRCm39) missense probably damaging 1.00
R0312:Lama1 UTSW 17 68,082,846 (GRCm39) missense possibly damaging 0.45
R0419:Lama1 UTSW 17 68,098,605 (GRCm39) critical splice donor site probably null
R0512:Lama1 UTSW 17 68,086,129 (GRCm39) missense possibly damaging 0.67
R0514:Lama1 UTSW 17 68,071,693 (GRCm39) missense probably benign 0.40
R0562:Lama1 UTSW 17 68,122,954 (GRCm39) missense probably damaging 1.00
R0632:Lama1 UTSW 17 68,059,363 (GRCm39) splice site probably benign
R0645:Lama1 UTSW 17 68,080,707 (GRCm39) missense probably benign 0.01
R0712:Lama1 UTSW 17 68,086,037 (GRCm39) splice site probably null
R0763:Lama1 UTSW 17 68,079,813 (GRCm39) missense probably damaging 0.97
R0941:Lama1 UTSW 17 68,082,860 (GRCm39) missense probably benign 0.10
R1025:Lama1 UTSW 17 68,059,893 (GRCm39) missense probably benign 0.00
R1084:Lama1 UTSW 17 68,111,464 (GRCm39) missense probably benign 0.12
R1103:Lama1 UTSW 17 68,097,942 (GRCm39) missense probably damaging 0.98
R1420:Lama1 UTSW 17 68,097,942 (GRCm39) missense probably damaging 0.98
R1430:Lama1 UTSW 17 68,089,150 (GRCm39) missense possibly damaging 0.95
R1569:Lama1 UTSW 17 68,087,613 (GRCm39) splice site probably null
R1575:Lama1 UTSW 17 68,117,404 (GRCm39) missense possibly damaging 0.96
R1613:Lama1 UTSW 17 68,114,918 (GRCm39) missense probably benign 0.42
R1620:Lama1 UTSW 17 68,074,028 (GRCm39) missense probably benign 0.01
R1629:Lama1 UTSW 17 68,112,423 (GRCm39) missense probably benign 0.00
R1645:Lama1 UTSW 17 68,044,677 (GRCm39) missense probably benign 0.14
R1652:Lama1 UTSW 17 68,114,841 (GRCm39) missense probably damaging 0.97
R1674:Lama1 UTSW 17 68,098,239 (GRCm39) missense probably benign
R1678:Lama1 UTSW 17 68,117,150 (GRCm39) missense possibly damaging 0.56
R1710:Lama1 UTSW 17 68,060,786 (GRCm39) missense probably benign 0.00
R1712:Lama1 UTSW 17 68,024,181 (GRCm39) missense possibly damaging 0.95
R1737:Lama1 UTSW 17 68,109,916 (GRCm39) missense probably benign 0.36
R1757:Lama1 UTSW 17 68,004,378 (GRCm39) missense unknown
R1757:Lama1 UTSW 17 68,070,831 (GRCm39) missense probably benign 0.40
R1813:Lama1 UTSW 17 68,098,218 (GRCm39) missense probably benign
R1896:Lama1 UTSW 17 68,098,218 (GRCm39) missense probably benign
R1945:Lama1 UTSW 17 68,052,848 (GRCm39) missense probably benign 0.14
R2086:Lama1 UTSW 17 68,124,618 (GRCm39) missense probably damaging 1.00
R2149:Lama1 UTSW 17 68,080,860 (GRCm39) missense possibly damaging 0.95
R2178:Lama1 UTSW 17 68,076,510 (GRCm39) missense probably benign 0.07
R2183:Lama1 UTSW 17 68,098,004 (GRCm39) missense probably damaging 0.98
R2197:Lama1 UTSW 17 68,059,936 (GRCm39) missense probably benign 0.02
R2213:Lama1 UTSW 17 68,084,029 (GRCm39) nonsense probably null
R2260:Lama1 UTSW 17 68,044,502 (GRCm39) missense probably damaging 0.96
R2356:Lama1 UTSW 17 68,117,109 (GRCm39) missense probably damaging 1.00
R2420:Lama1 UTSW 17 68,057,548 (GRCm39) missense probably benign 0.00
R2421:Lama1 UTSW 17 68,057,548 (GRCm39) missense probably benign 0.00
R2422:Lama1 UTSW 17 68,057,548 (GRCm39) missense probably benign 0.00
R2424:Lama1 UTSW 17 68,105,660 (GRCm39) missense probably benign 0.09
R2442:Lama1 UTSW 17 68,075,312 (GRCm39) missense probably benign 0.04
R3147:Lama1 UTSW 17 68,044,653 (GRCm39) missense probably damaging 0.98
R3414:Lama1 UTSW 17 68,044,598 (GRCm39) missense probably damaging 1.00
R3683:Lama1 UTSW 17 68,075,328 (GRCm39) missense probably benign 0.40
R3820:Lama1 UTSW 17 68,086,041 (GRCm39) splice site probably null
R3821:Lama1 UTSW 17 68,086,041 (GRCm39) splice site probably null
R3822:Lama1 UTSW 17 68,086,041 (GRCm39) splice site probably null
R4012:Lama1 UTSW 17 68,119,368 (GRCm39) nonsense probably null
R4113:Lama1 UTSW 17 68,071,698 (GRCm39) missense probably benign 0.01
R4133:Lama1 UTSW 17 68,119,481 (GRCm39) missense probably damaging 1.00
R4133:Lama1 UTSW 17 68,057,650 (GRCm39) missense probably damaging 0.98
R4259:Lama1 UTSW 17 68,059,413 (GRCm39) missense possibly damaging 0.95
R4278:Lama1 UTSW 17 68,098,512 (GRCm39) missense probably null 0.00
R4321:Lama1 UTSW 17 68,078,078 (GRCm39) missense probably benign 0.03
R4374:Lama1 UTSW 17 68,111,513 (GRCm39) missense probably benign 0.00
R4386:Lama1 UTSW 17 68,080,707 (GRCm39) missense probably benign 0.01
R4463:Lama1 UTSW 17 68,068,695 (GRCm39) missense probably damaging 1.00
R4629:Lama1 UTSW 17 68,112,355 (GRCm39) critical splice acceptor site probably null
R4630:Lama1 UTSW 17 68,101,295 (GRCm39) missense probably benign 0.00
R4633:Lama1 UTSW 17 68,105,579 (GRCm39) missense probably damaging 0.96
R4668:Lama1 UTSW 17 68,059,429 (GRCm39) missense probably benign 0.27
R4684:Lama1 UTSW 17 68,080,773 (GRCm39) missense possibly damaging 0.88
R4745:Lama1 UTSW 17 68,045,775 (GRCm39) missense probably damaging 1.00
R4786:Lama1 UTSW 17 68,080,854 (GRCm39) missense possibly damaging 0.77
R4797:Lama1 UTSW 17 68,023,770 (GRCm39) missense probably benign 0.04
R4803:Lama1 UTSW 17 68,116,266 (GRCm39) missense probably damaging 1.00
R4925:Lama1 UTSW 17 68,101,309 (GRCm39) missense probably benign 0.02
R4939:Lama1 UTSW 17 68,044,470 (GRCm39) missense possibly damaging 0.91
R4952:Lama1 UTSW 17 68,074,561 (GRCm39) critical splice donor site probably null
R4975:Lama1 UTSW 17 68,045,829 (GRCm39) missense possibly damaging 0.95
R4977:Lama1 UTSW 17 68,044,677 (GRCm39) missense probably damaging 1.00
R5039:Lama1 UTSW 17 68,052,888 (GRCm39) missense possibly damaging 0.66
R5047:Lama1 UTSW 17 68,050,276 (GRCm39) nonsense probably null
R5195:Lama1 UTSW 17 68,071,795 (GRCm39) missense probably benign 0.13
R5230:Lama1 UTSW 17 68,052,078 (GRCm39) nonsense probably null
R5236:Lama1 UTSW 17 68,111,487 (GRCm39) missense probably benign 0.24
R5254:Lama1 UTSW 17 68,063,711 (GRCm39) missense probably benign 0.01
R5345:Lama1 UTSW 17 68,124,558 (GRCm39) missense probably benign
R5438:Lama1 UTSW 17 68,107,769 (GRCm39) missense possibly damaging 0.92
R5521:Lama1 UTSW 17 68,087,889 (GRCm39) nonsense probably null
R5568:Lama1 UTSW 17 68,075,293 (GRCm39) critical splice acceptor site probably null
R5645:Lama1 UTSW 17 68,109,943 (GRCm39) missense probably damaging 1.00
R5665:Lama1 UTSW 17 68,077,982 (GRCm39) missense probably damaging 1.00
R5727:Lama1 UTSW 17 68,122,219 (GRCm39) missense possibly damaging 0.81
R5757:Lama1 UTSW 17 68,045,782 (GRCm39) missense possibly damaging 0.59
R5795:Lama1 UTSW 17 68,103,722 (GRCm39) missense probably benign 0.02
R5857:Lama1 UTSW 17 68,114,838 (GRCm39) missense probably damaging 0.99
R5894:Lama1 UTSW 17 68,086,042 (GRCm39) critical splice acceptor site probably null
R5974:Lama1 UTSW 17 68,080,722 (GRCm39) missense probably benign 0.31
R6032:Lama1 UTSW 17 68,057,638 (GRCm39) missense probably benign 0.01
R6032:Lama1 UTSW 17 68,057,638 (GRCm39) missense probably benign 0.01
R6120:Lama1 UTSW 17 68,087,612 (GRCm39) critical splice donor site probably null
R6219:Lama1 UTSW 17 68,097,851 (GRCm39) missense probably benign 0.08
R6224:Lama1 UTSW 17 68,109,982 (GRCm39) missense possibly damaging 0.56
R6249:Lama1 UTSW 17 68,105,599 (GRCm39) missense probably benign
R6265:Lama1 UTSW 17 68,057,650 (GRCm39) missense probably damaging 0.98
R6276:Lama1 UTSW 17 68,091,083 (GRCm39) splice site probably null
R6284:Lama1 UTSW 17 68,117,091 (GRCm39) missense probably damaging 0.99
R6337:Lama1 UTSW 17 68,093,014 (GRCm39) missense probably benign 0.27
R6414:Lama1 UTSW 17 68,053,905 (GRCm39) critical splice donor site probably null
R6631:Lama1 UTSW 17 68,081,477 (GRCm39) missense probably benign 0.21
R6659:Lama1 UTSW 17 68,125,630 (GRCm39) missense probably damaging 1.00
R6660:Lama1 UTSW 17 68,111,495 (GRCm39) missense probably benign 0.05
R6677:Lama1 UTSW 17 68,102,228 (GRCm39) missense probably benign 0.14
R6763:Lama1 UTSW 17 68,053,868 (GRCm39) missense unknown
R6787:Lama1 UTSW 17 68,091,020 (GRCm39) missense unknown
R6831:Lama1 UTSW 17 68,063,749 (GRCm39) missense possibly damaging 0.89
R6855:Lama1 UTSW 17 68,089,150 (GRCm39) missense possibly damaging 0.95
R6910:Lama1 UTSW 17 68,098,459 (GRCm39) missense possibly damaging 0.60
R6934:Lama1 UTSW 17 68,081,538 (GRCm39) missense probably benign 0.04
R6945:Lama1 UTSW 17 68,120,861 (GRCm39) missense
R6984:Lama1 UTSW 17 68,086,107 (GRCm39) missense
R6989:Lama1 UTSW 17 68,060,753 (GRCm39) missense
R6994:Lama1 UTSW 17 68,060,820 (GRCm39) missense
R6995:Lama1 UTSW 17 68,060,820 (GRCm39) missense
R7035:Lama1 UTSW 17 68,088,044 (GRCm39) missense
R7133:Lama1 UTSW 17 68,089,141 (GRCm39) missense
R7172:Lama1 UTSW 17 68,111,540 (GRCm39) missense
R7197:Lama1 UTSW 17 68,044,700 (GRCm39) nonsense probably null
R7217:Lama1 UTSW 17 68,071,668 (GRCm39) missense
R7229:Lama1 UTSW 17 68,059,441 (GRCm39) missense
R7264:Lama1 UTSW 17 68,050,292 (GRCm39) missense
R7311:Lama1 UTSW 17 68,074,380 (GRCm39) missense
R7394:Lama1 UTSW 17 68,024,256 (GRCm39) missense
R7419:Lama1 UTSW 17 68,024,169 (GRCm39) missense
R7460:Lama1 UTSW 17 68,074,013 (GRCm39) missense
R7492:Lama1 UTSW 17 68,124,646 (GRCm39) missense
R7494:Lama1 UTSW 17 68,118,441 (GRCm39) missense
R7552:Lama1 UTSW 17 68,044,662 (GRCm39) missense
R7583:Lama1 UTSW 17 68,068,616 (GRCm39) missense
R7649:Lama1 UTSW 17 68,044,549 (GRCm39) missense
R7663:Lama1 UTSW 17 68,087,875 (GRCm39) missense
R7667:Lama1 UTSW 17 68,087,592 (GRCm39) missense
R7688:Lama1 UTSW 17 68,068,623 (GRCm39) missense
R7693:Lama1 UTSW 17 68,124,026 (GRCm39) missense
R7748:Lama1 UTSW 17 68,057,585 (GRCm39) missense
R7778:Lama1 UTSW 17 68,111,468 (GRCm39) missense
R7824:Lama1 UTSW 17 68,111,468 (GRCm39) missense
R7861:Lama1 UTSW 17 68,116,216 (GRCm39) missense
R7884:Lama1 UTSW 17 68,076,430 (GRCm39) missense
R8029:Lama1 UTSW 17 68,124,589 (GRCm39) missense
R8078:Lama1 UTSW 17 68,098,289 (GRCm39) missense
R8101:Lama1 UTSW 17 68,052,917 (GRCm39) missense
R8313:Lama1 UTSW 17 68,057,515 (GRCm39) missense
R8356:Lama1 UTSW 17 68,044,491 (GRCm39) missense
R8366:Lama1 UTSW 17 68,125,699 (GRCm39) missense
R8403:Lama1 UTSW 17 68,052,918 (GRCm39) missense
R8456:Lama1 UTSW 17 68,044,491 (GRCm39) missense
R8466:Lama1 UTSW 17 68,120,948 (GRCm39) missense
R8678:Lama1 UTSW 17 68,124,098 (GRCm39) missense
R8728:Lama1 UTSW 17 68,125,663 (GRCm39) missense
R8796:Lama1 UTSW 17 68,117,146 (GRCm39) missense
R8885:Lama1 UTSW 17 68,080,779 (GRCm39) missense
R8893:Lama1 UTSW 17 68,112,367 (GRCm39) missense
R8898:Lama1 UTSW 17 68,128,610 (GRCm39) missense
R8909:Lama1 UTSW 17 68,079,736 (GRCm39) missense
R9025:Lama1 UTSW 17 68,119,491 (GRCm39) missense
R9045:Lama1 UTSW 17 68,060,838 (GRCm39) missense
R9098:Lama1 UTSW 17 68,111,508 (GRCm39) missense
R9114:Lama1 UTSW 17 68,128,669 (GRCm39) missense
R9173:Lama1 UTSW 17 68,076,597 (GRCm39) missense
R9190:Lama1 UTSW 17 68,111,514 (GRCm39) missense
R9381:Lama1 UTSW 17 68,044,479 (GRCm39) missense
R9429:Lama1 UTSW 17 68,118,449 (GRCm39) missense
R9504:Lama1 UTSW 17 68,128,661 (GRCm39) missense
R9558:Lama1 UTSW 17 68,124,004 (GRCm39) missense
R9647:Lama1 UTSW 17 68,024,170 (GRCm39) missense
R9651:Lama1 UTSW 17 68,101,215 (GRCm39) missense
R9654:Lama1 UTSW 17 68,101,266 (GRCm39) missense
R9710:Lama1 UTSW 17 68,129,404 (GRCm39) missense
R9733:Lama1 UTSW 17 68,116,940 (GRCm39) missense
RF001:Lama1 UTSW 17 68,059,897 (GRCm39) missense
RF013:Lama1 UTSW 17 68,088,057 (GRCm39) missense
V8831:Lama1 UTSW 17 68,059,878 (GRCm39) missense probably benign 0.00
X0024:Lama1 UTSW 17 68,045,883 (GRCm39) missense probably damaging 1.00
X0028:Lama1 UTSW 17 68,101,305 (GRCm39) missense probably benign 0.06
X0028:Lama1 UTSW 17 68,074,417 (GRCm39) missense probably benign 0.00
X0066:Lama1 UTSW 17 68,118,561 (GRCm39) missense probably damaging 1.00
Z1088:Lama1 UTSW 17 68,117,166 (GRCm39) missense probably damaging 1.00
Z1088:Lama1 UTSW 17 68,078,077 (GRCm39) missense probably benign 0.25
Z1088:Lama1 UTSW 17 68,059,878 (GRCm39) missense probably benign 0.00
Z1176:Lama1 UTSW 17 68,059,878 (GRCm39) missense probably benign 0.00
Z1177:Lama1 UTSW 17 68,059,878 (GRCm39) missense probably benign 0.00
Z1191:Lama1 UTSW 17 68,105,639 (GRCm39) missense
Predicted Primers PCR Primer
(F):5'- CCTTTCTTTGTGACACTGAGGG -3'
(R):5'- TCAGTGACAGCTGTTCCTAGC -3'

Sequencing Primer
(F):5'- CACCTGGTTGAGAATTGCAGCTC -3'
(R):5'- ACAGCTGTTCCTAGCCACCATC -3'
Posted On 2019-10-24