Incidental Mutation 'R7576:Hnrnpll'
ID 586456
Institutional Source Beutler Lab
Gene Symbol Hnrnpll
Ensembl Gene ENSMUSG00000024095
Gene Name heterogeneous nuclear ribonucleoprotein L-like
Synonyms Hnrpll, 2510028H02Rik, 2810036L13Rik
MMRRC Submission 045661-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.874) question?
Stock # R7576 (G1)
Quality Score 225.009
Status Not validated
Chromosome 17
Chromosomal Location 80336916-80369697 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 80351943 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Leucine at position 334 (S334L)
Ref Sequence ENSEMBL: ENSMUSP00000139372 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061331] [ENSMUST00000184297] [ENSMUST00000184635]
AlphaFold Q921F4
Predicted Effect possibly damaging
Transcript: ENSMUST00000061331
AA Change: S334L

PolyPhen 2 Score 0.911 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000058308
Gene: ENSMUSG00000024095
AA Change: S334L

DomainStartEndE-ValueType
low complexity region 52 104 N/A INTRINSIC
RRM 126 195 2.99e-4 SMART
RRM 216 289 1.26e-2 SMART
low complexity region 314 325 N/A INTRINSIC
RRM 385 454 1.36e-7 SMART
Blast:RRM_2 504 582 3e-32 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000184297
SMART Domains Protein: ENSMUSP00000139075
Gene: ENSMUSG00000024095

DomainStartEndE-ValueType
low complexity region 52 104 N/A INTRINSIC
RRM 126 195 2.99e-4 SMART
RRM 216 289 1.26e-2 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000184635
AA Change: S334L

PolyPhen 2 Score 0.911 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000139372
Gene: ENSMUSG00000024095
AA Change: S334L

DomainStartEndE-ValueType
low complexity region 52 104 N/A INTRINSIC
RRM 126 195 2.99e-4 SMART
RRM 216 289 1.26e-2 SMART
low complexity region 314 325 N/A INTRINSIC
RRM 385 454 1.36e-7 SMART
Blast:RRM_2 504 582 3e-32 BLAST
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] HNRNPLL is a master regulator of activation-induced alternative splicing in T cells. In particular, it alters splicing of CD45 (PTPRC; MIM 151460), a tyrosine phosphatase essential for T-cell development and activation (Oberdoerffer et al., 2008 [PubMed 18669861]).[supplied by OMIM, Aug 2008]
PHENOTYPE: Mice homozygous for a point mutation in a RNA recognition motif of the gene product have defects in the generation of alternative transcripts normally found in memory T cells. Total CD4+ T cell counts are lower, with a reduction of na�ve CD44lo T cells occurring as mice age. [provided by MGI curators]
Allele List at MGI

All alleles(6) : Gene trapped(5) Chemically induced(1)

Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ahdc1 A T 4: 132,792,313 (GRCm39) S1185C possibly damaging Het
Akap9 C G 5: 4,018,745 (GRCm39) H1109D probably benign Het
Alpk2 T C 18: 65,439,887 (GRCm39) D502G possibly damaging Het
Bcl2 A G 1: 106,640,153 (GRCm39) V153A possibly damaging Het
Brinp3 A T 1: 146,777,301 (GRCm39) S583C probably damaging Het
Calr4 A T 4: 109,096,161 (GRCm39) Q113L probably benign Het
Carm1 T G 9: 21,497,832 (GRCm39) probably null Het
Ccdc30 A G 4: 119,207,063 (GRCm39) L353P probably damaging Het
Ccdc91 C G 6: 147,491,957 (GRCm39) Q280E unknown Het
Cdk5rap2 T C 4: 70,185,109 (GRCm39) T1114A probably benign Het
Ciao3 A C 17: 25,997,944 (GRCm39) T154P probably damaging Het
Dync2i2 C T 2: 29,938,790 (GRCm39) R31Q probably benign Het
Enpep T A 3: 129,077,740 (GRCm39) T626S probably benign Het
Epcam T C 17: 87,947,721 (GRCm39) S64P probably damaging Het
Erc1 G T 6: 119,801,721 (GRCm39) P99T possibly damaging Het
Fastkd1 A G 2: 69,524,988 (GRCm39) L636S probably damaging Het
Fmn1 A G 2: 113,195,353 (GRCm39) D351G unknown Het
Fndc8 T G 11: 82,788,400 (GRCm39) S77A probably damaging Het
Gbp10 G A 5: 105,384,015 (GRCm39) probably benign Het
Gemin6 T A 17: 80,533,155 (GRCm39) Y29* probably null Het
Gja8 T C 3: 96,827,209 (GRCm39) E151G probably benign Het
Gje1 A G 10: 14,592,501 (GRCm39) Y94H probably damaging Het
Glt6d1 A G 2: 25,704,134 (GRCm39) F26S probably benign Het
Gltpd2 T A 11: 70,410,306 (GRCm39) probably null Het
Gm10153 A C 7: 141,743,859 (GRCm39) C70G unknown Het
Gm28729 G A 9: 96,376,410 (GRCm39) T368M probably damaging Het
Gm4559 A G 7: 141,827,677 (GRCm39) C142R unknown Het
Golm1 T C 13: 59,792,920 (GRCm39) N195S probably benign Het
Hectd4 A T 5: 121,487,522 (GRCm39) S3506C possibly damaging Het
Ighv7-3 A T 12: 114,116,865 (GRCm39) I99N possibly damaging Het
Igkv8-24 A G 6: 70,194,002 (GRCm39) S69P not run Het
Ilvbl A T 10: 78,419,531 (GRCm39) H537L possibly damaging Het
Lama1 G A 17: 68,089,036 (GRCm39) G1569D Het
Lin7b A T 7: 45,018,649 (GRCm39) Y118* probably null Het
Mansc1 T A 6: 134,587,674 (GRCm39) S168C possibly damaging Het
Mast3 A G 8: 71,233,838 (GRCm39) V969A probably damaging Het
Muc4 C T 16: 32,754,500 (GRCm38) T1458I probably benign Het
Myh10 A G 11: 68,692,992 (GRCm39) E1429G probably damaging Het
Neurod1 G T 2: 79,284,689 (GRCm39) Y231* probably null Het
Nrxn2 G T 19: 6,581,540 (GRCm39) E1492* probably null Het
Nwd2 A G 5: 63,964,736 (GRCm39) Q1440R probably benign Het
Or10j3b A G 1: 173,043,538 (GRCm39) T107A probably benign Het
Or6z7 T A 7: 6,483,330 (GRCm39) N275I probably damaging Het
Or8u3-ps A G 2: 85,952,720 (GRCm39) Y151C probably damaging Het
Pacs1 T A 19: 5,195,148 (GRCm39) T479S probably benign Het
Pds5b A G 5: 150,701,726 (GRCm39) K786E probably damaging Het
Pigp A G 16: 94,171,264 (GRCm39) L9P probably benign Het
Plec C T 15: 76,071,946 (GRCm39) R707Q unknown Het
Ppef2 T A 5: 92,400,993 (GRCm39) H9L possibly damaging Het
Ppid T A 3: 79,507,698 (GRCm39) C296S probably damaging Het
Ppp2r5b T G 19: 6,278,514 (GRCm39) E465A possibly damaging Het
Ppp4r4 A G 12: 103,562,708 (GRCm39) N559S probably damaging Het
Ptprt T C 2: 161,449,225 (GRCm39) T873A possibly damaging Het
Rbpms A G 8: 34,356,416 (GRCm39) V28A probably damaging Het
Retreg2 A G 1: 75,121,332 (GRCm39) M203V probably damaging Het
Rfx4 A G 10: 84,699,213 (GRCm39) E367G probably damaging Het
Robo1 C T 16: 72,767,069 (GRCm39) P414S probably damaging Het
Sac3d1 T A 19: 6,166,178 (GRCm39) E410D probably damaging Het
Scgb2b19 A T 7: 32,979,211 (GRCm39) C24S possibly damaging Het
She T C 3: 89,738,919 (GRCm39) F37L probably damaging Het
Slc5a2 G A 7: 127,864,977 (GRCm39) V37I probably damaging Het
Smyd4 T A 11: 75,281,032 (GRCm39) D168E probably benign Het
Ssc5d C A 7: 4,931,572 (GRCm39) P260T probably damaging Het
Steap2 A G 5: 5,727,406 (GRCm39) F310L probably benign Het
Tctn1 A T 5: 122,386,071 (GRCm39) I347N probably damaging Het
Tmtc2 A G 10: 105,206,482 (GRCm39) L271P probably damaging Het
Tns3 T A 11: 8,491,192 (GRCm39) M122L possibly damaging Het
Ubr7 T G 12: 102,735,398 (GRCm39) C286G probably damaging Het
Usp16 T C 16: 87,276,188 (GRCm39) S509P probably benign Het
Usp44 A G 10: 93,682,290 (GRCm39) T247A probably damaging Het
Vmn2r92 A C 17: 18,387,621 (GRCm39) M209L probably benign Het
Zc3h6 C T 2: 128,856,473 (GRCm39) P518S probably damaging Het
Zfp229 A G 17: 21,964,280 (GRCm39) H170R probably damaging Het
Zfp960 A G 17: 17,308,227 (GRCm39) T314A probably benign Het
Other mutations in Hnrnpll
AlleleSourceChrCoordTypePredicted EffectPPH Score
thunder APN 17 80,361,000 (GRCm39) missense probably damaging 1.00
IGL01989:Hnrnpll APN 17 80,346,169 (GRCm39) missense probably benign 0.15
IGL02093:Hnrnpll APN 17 80,351,933 (GRCm39) missense probably benign 0.00
IGL02141:Hnrnpll APN 17 80,358,142 (GRCm39) missense probably benign 0.02
IGL02749:Hnrnpll APN 17 80,369,420 (GRCm39) start codon destroyed probably null
IGL03213:Hnrnpll APN 17 80,341,527 (GRCm39) missense probably damaging 1.00
Grell UTSW 17 80,341,534 (GRCm39) missense probably damaging 1.00
Lindsley UTSW 17 80,357,276 (GRCm39) missense probably damaging 1.00
R0477:Hnrnpll UTSW 17 80,369,261 (GRCm39) missense unknown
R1599:Hnrnpll UTSW 17 80,361,054 (GRCm39) missense unknown
R1700:Hnrnpll UTSW 17 80,341,534 (GRCm39) missense probably benign 0.18
R1838:Hnrnpll UTSW 17 80,346,052 (GRCm39) missense probably damaging 1.00
R1907:Hnrnpll UTSW 17 80,342,758 (GRCm39) critical splice donor site probably null
R1978:Hnrnpll UTSW 17 80,351,947 (GRCm39) missense probably benign 0.01
R2079:Hnrnpll UTSW 17 80,342,806 (GRCm39) missense probably benign 0.01
R4061:Hnrnpll UTSW 17 80,340,201 (GRCm39) missense probably benign 0.01
R4062:Hnrnpll UTSW 17 80,340,201 (GRCm39) missense probably benign 0.01
R4064:Hnrnpll UTSW 17 80,340,201 (GRCm39) missense probably benign 0.01
R4226:Hnrnpll UTSW 17 80,357,234 (GRCm39) critical splice donor site probably null
R4625:Hnrnpll UTSW 17 80,358,291 (GRCm39) nonsense probably null
R5175:Hnrnpll UTSW 17 80,341,499 (GRCm39) missense possibly damaging 0.83
R5232:Hnrnpll UTSW 17 80,346,107 (GRCm39) missense probably damaging 1.00
R5620:Hnrnpll UTSW 17 80,346,051 (GRCm39) missense probably damaging 1.00
R5978:Hnrnpll UTSW 17 80,341,620 (GRCm39) missense probably damaging 1.00
R6183:Hnrnpll UTSW 17 80,357,305 (GRCm39) missense possibly damaging 0.46
R6374:Hnrnpll UTSW 17 80,357,303 (GRCm39) missense possibly damaging 0.51
R7120:Hnrnpll UTSW 17 80,341,486 (GRCm39) missense probably benign 0.01
R7429:Hnrnpll UTSW 17 80,357,276 (GRCm39) missense probably damaging 1.00
R7430:Hnrnpll UTSW 17 80,357,276 (GRCm39) missense probably damaging 1.00
R8001:Hnrnpll UTSW 17 80,346,152 (GRCm39) nonsense probably null
R8010:Hnrnpll UTSW 17 80,369,385 (GRCm39) missense unknown
R8060:Hnrnpll UTSW 17 80,341,534 (GRCm39) missense probably damaging 1.00
R8068:Hnrnpll UTSW 17 80,358,281 (GRCm39) missense possibly damaging 0.80
R8381:Hnrnpll UTSW 17 80,337,920 (GRCm39) missense probably damaging 1.00
R9378:Hnrnpll UTSW 17 80,369,291 (GRCm39) missense unknown
R9488:Hnrnpll UTSW 17 80,369,385 (GRCm39) missense unknown
Z1177:Hnrnpll UTSW 17 80,356,039 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- CAAAGGTTTTGGACAACTTCTTGG -3'
(R):5'- TGTACATTCACTTCCTGCAAAGC -3'

Sequencing Primer
(F):5'- TCTTGGAAATAAACTACAACAGGAG -3'
(R):5'- CCTGCAAAGCACCTAATCTTTTAC -3'
Posted On 2019-10-24