Incidental Mutation 'R7576:Ppp2r5b'
ID586462
Institutional Source Beutler Lab
Gene Symbol Ppp2r5b
Ensembl Gene ENSMUSG00000024777
Gene Nameprotein phosphatase 2, regulatory subunit B', beta
SynonymsB'beta
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.508) question?
Stock #R7576 (G1)
Quality Score225.009
Status Not validated
Chromosome19
Chromosomal Location6227765-6235872 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 6228484 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Alanine at position 465 (E465A)
Ref Sequence ENSEMBL: ENSMUSP00000025695 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025695] [ENSMUST00000025698] [ENSMUST00000025699] [ENSMUST00000113526] [ENSMUST00000113528]
Predicted Effect possibly damaging
Transcript: ENSMUST00000025695
AA Change: E465A

PolyPhen 2 Score 0.762 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000025695
Gene: ENSMUSG00000024777
AA Change: E465A

DomainStartEndE-ValueType
low complexity region 6 25 N/A INTRINSIC
low complexity region 32 48 N/A INTRINSIC
Pfam:B56 62 467 5.2e-187 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000025698
SMART Domains Protein: ENSMUSP00000025698
Gene: ENSMUSG00000024784

DomainStartEndE-ValueType
low complexity region 8 15 N/A INTRINSIC
Pfam:DAN 17 126 5.1e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000025699
SMART Domains Protein: ENSMUSP00000025699
Gene: ENSMUSG00000024786

DomainStartEndE-ValueType
Pfam:DUF4544 1 51 2.1e-36 PFAM
Pfam:DUF4544 49 110 2.1e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113526
SMART Domains Protein: ENSMUSP00000109154
Gene: ENSMUSG00000024784

DomainStartEndE-ValueType
low complexity region 8 15 N/A INTRINSIC
Pfam:DAN 16 123 1.9e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113528
SMART Domains Protein: ENSMUSP00000109156
Gene: ENSMUSG00000024786

DomainStartEndE-ValueType
Pfam:DUF4544 1 240 1.5e-131 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene belongs to the phosphatase 2A regulatory subunit B family. Protein phosphatase 2A is one of the four major Ser/Thr phosphatases, and it is implicated in the negative control of cell growth and division. It consists of a common heteromeric core enzyme, which is composed of a catalytic subunit and a constant regulatory subunit, that associates with a variety of regulatory subunits. The B regulatory subunit might modulate substrate selectivity and catalytic activity. This gene encodes a beta isoform of the regulatory subunit B56 subfamily. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ahdc1 A T 4: 133,065,002 S1185C possibly damaging Het
Akap9 C G 5: 3,968,745 H1109D probably benign Het
Alpk2 T C 18: 65,306,816 D502G possibly damaging Het
Bcl2 A G 1: 106,712,423 V153A possibly damaging Het
Brinp3 A T 1: 146,901,563 S583C probably damaging Het
Calr4 A T 4: 109,238,964 Q113L probably benign Het
Carm1 T G 9: 21,586,536 probably null Het
Ccdc30 A G 4: 119,349,866 L353P probably damaging Het
Ccdc91 C G 6: 147,590,459 Q280E unknown Het
Cdk5rap2 T C 4: 70,266,872 T1114A probably benign Het
Enpep T A 3: 129,284,091 T626S probably benign Het
Epcam T C 17: 87,640,293 S64P probably damaging Het
Erc1 G T 6: 119,824,760 P99T possibly damaging Het
Fastkd1 A G 2: 69,694,644 L636S probably damaging Het
Fmn1 A G 2: 113,365,008 D351G unknown Het
Fndc8 T G 11: 82,897,574 S77A probably damaging Het
Gbp10 G A 5: 105,236,149 probably benign Het
Gemin6 T A 17: 80,225,726 Y29* probably null Het
Gja8 T C 3: 96,919,893 E151G probably benign Het
Gje1 A G 10: 14,716,757 Y94H probably damaging Het
Glt6d1 A G 2: 25,814,122 F26S probably benign Het
Gltpd2 T A 11: 70,519,480 probably null Het
Gm10153 A C 7: 142,190,122 C70G unknown Het
Gm28729 G A 9: 96,494,357 T368M probably damaging Het
Gm4559 A G 7: 142,273,940 C142R unknown Het
Golm1 T C 13: 59,645,106 N195S probably benign Het
Hectd4 A T 5: 121,349,459 S3506C possibly damaging Het
Hnrnpll G A 17: 80,044,514 S334L possibly damaging Het
Ighv7-3 A T 12: 114,153,245 I99N possibly damaging Het
Igkv8-24 A G 6: 70,217,018 S69P not run Het
Ilvbl A T 10: 78,583,697 H537L possibly damaging Het
Lama1 G A 17: 67,782,041 G1569D Het
Lin7b A T 7: 45,369,225 Y118* probably null Het
Mansc1 T A 6: 134,610,711 S168C possibly damaging Het
Mast3 A G 8: 70,781,194 V969A probably damaging Het
Muc4 C T 16: 32,754,500 T1458I probably benign Het
Myh10 A G 11: 68,802,166 E1429G probably damaging Het
Narfl A C 17: 25,778,970 T154P probably damaging Het
Neurod1 G T 2: 79,454,345 Y231* probably null Het
Nrxn2 G T 19: 6,531,510 E1492* probably null Het
Nwd2 A G 5: 63,807,393 Q1440R probably benign Het
Olfr1038-ps A G 2: 86,122,376 Y151C probably damaging Het
Olfr1404 A G 1: 173,215,971 T107A probably benign Het
Olfr5 T A 7: 6,480,331 N275I probably damaging Het
Pacs1 T A 19: 5,145,120 T479S probably benign Het
Pds5b A G 5: 150,778,261 K786E probably damaging Het
Pigp A G 16: 94,370,405 L9P probably benign Het
Plec C T 15: 76,187,746 R707Q unknown Het
Ppef2 T A 5: 92,253,134 H9L possibly damaging Het
Ppid T A 3: 79,600,391 C296S probably damaging Het
Ppp4r4 A G 12: 103,596,449 N559S probably damaging Het
Ptprt T C 2: 161,607,305 T873A possibly damaging Het
Rbpms A G 8: 33,866,388 V28A probably damaging Het
Retreg2 A G 1: 75,144,688 M203V probably damaging Het
Rfx4 A G 10: 84,863,349 E367G probably damaging Het
Robo1 C T 16: 72,970,181 P414S probably damaging Het
Sac3d1 T A 19: 6,116,148 E410D probably damaging Het
Scgb2b19 A T 7: 33,279,786 C24S possibly damaging Het
She T C 3: 89,831,612 F37L probably damaging Het
Slc5a2 G A 7: 128,265,805 V37I probably damaging Het
Smyd4 T A 11: 75,390,206 D168E probably benign Het
Ssc5d C A 7: 4,928,573 P260T probably damaging Het
Steap2 A G 5: 5,677,406 F310L probably benign Het
Tctn1 A T 5: 122,248,008 I347N probably damaging Het
Tmtc2 A G 10: 105,370,621 L271P probably damaging Het
Tns3 T A 11: 8,541,192 M122L possibly damaging Het
Ubr7 T G 12: 102,769,139 C286G probably damaging Het
Usp16 T C 16: 87,479,300 S509P probably benign Het
Usp44 A G 10: 93,846,428 T247A probably damaging Het
Vmn2r92 A C 17: 18,167,359 M209L probably benign Het
Wdr34 C T 2: 30,048,778 R31Q probably benign Het
Zc3h6 C T 2: 129,014,553 P518S probably damaging Het
Zfp229 A G 17: 21,745,299 H170R probably damaging Het
Zfp960 A G 17: 17,087,965 T314A probably benign Het
Other mutations in Ppp2r5b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00598:Ppp2r5b APN 19 6230968 missense probably damaging 1.00
IGL02714:Ppp2r5b APN 19 6234707 missense probably damaging 0.99
IGL02937:Ppp2r5b APN 19 6230986 missense probably damaging 1.00
PIT4696001:Ppp2r5b UTSW 19 6234683 missense probably benign 0.12
R0114:Ppp2r5b UTSW 19 6228431 missense probably benign
R0333:Ppp2r5b UTSW 19 6229047 unclassified probably benign
R0627:Ppp2r5b UTSW 19 6232634 unclassified probably benign
R1477:Ppp2r5b UTSW 19 6230227 missense probably benign 0.01
R1628:Ppp2r5b UTSW 19 6230905 critical splice donor site probably null
R4066:Ppp2r5b UTSW 19 6229330 missense probably damaging 1.00
R4834:Ppp2r5b UTSW 19 6230510 missense possibly damaging 0.81
R5854:Ppp2r5b UTSW 19 6230944 missense probably damaging 1.00
R5895:Ppp2r5b UTSW 19 6234734 missense probably damaging 1.00
R6102:Ppp2r5b UTSW 19 6234738 missense probably benign 0.00
R6285:Ppp2r5b UTSW 19 6230536 missense probably benign 0.08
R7087:Ppp2r5b UTSW 19 6232550 missense possibly damaging 0.46
R7391:Ppp2r5b UTSW 19 6228514 missense probably benign 0.00
R7799:Ppp2r5b UTSW 19 6232598 missense probably benign 0.43
Predicted Primers PCR Primer
(F):5'- TCCGTGAAAGCTGTTCCCAC -3'
(R):5'- CCTCACATCTTTTCTAAGCTGAGG -3'

Sequencing Primer
(F):5'- TAGGGAGTCCTAGAGCCACTC -3'
(R):5'- AGGGTTCCCATGGAGTCCTAATC -3'
Posted On2019-10-24