Incidental Mutation 'R7577:Fam129a'
ID586467
Institutional Source Beutler Lab
Gene Symbol Fam129a
Ensembl Gene ENSMUSG00000026483
Gene Namefamily with sequence similarity 129, member A
SynonymsNiban
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7577 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location151571186-151721939 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 151718312 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 916 (V916E)
Ref Sequence ENSEMBL: ENSMUSP00000115822 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000097541] [ENSMUST00000148810]
Predicted Effect probably benign
Transcript: ENSMUST00000097541
SMART Domains Protein: ENSMUSP00000095148
Gene: ENSMUSG00000026483

DomainStartEndE-ValueType
Blast:PH 70 197 2e-83 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000148810
AA Change: V916E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000115822
Gene: ENSMUSG00000026483
AA Change: V916E

DomainStartEndE-ValueType
SCOP:d1faoa_ 67 118 1e-2 SMART
Blast:PH 70 197 1e-80 BLAST
low complexity region 540 549 N/A INTRINSIC
low complexity region 699 714 N/A INTRINSIC
low complexity region 784 797 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the family with sequence similarity 129 protein family. This gene is highly expressed in several cancer cells and may serve as a prognostic marker for certain cancers. The encoded protein may play a role in regulating p53-mediated apoptosis. [provided by RefSeq, Sep 2016]
PHENOTYPE: Mice homozygous for a knock-out allele are viable with no overt phenotypic abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610008E11Rik C T 10: 79,066,491 V664M possibly damaging Het
4931423N10Rik A G 2: 23,207,825 Y5C probably benign Het
9530053A07Rik A G 7: 28,154,423 D1604G possibly damaging Het
Abca4 A G 3: 122,174,014 T2238A probably damaging Het
Adss G A 1: 177,767,697 Q426* probably null Het
Afap1l2 T C 19: 56,944,767 E71G probably damaging Het
Afg1l T C 10: 42,318,611 D395G probably damaging Het
Akap9 C G 5: 3,968,745 H1109D probably benign Het
Alms1 A G 6: 85,615,320 T385A probably benign Het
Ank3 C T 10: 69,992,572 T2357I Het
Ankfn1 T A 11: 89,503,971 S263C probably benign Het
Azin1 C T 15: 38,501,421 V29I probably benign Het
B3galt2 T C 1: 143,647,304 Y393H probably damaging Het
Cnbd2 G T 2: 156,328,376 R127L possibly damaging Het
Col6a5 A T 9: 105,864,688 L2344* probably null Het
Csn3 T C 5: 87,929,962 V109A not run Het
Cxcr2 C G 1: 74,158,915 N189K probably benign Het
Dclre1a A G 19: 56,529,533 F1038S probably damaging Het
Ddx21 T C 10: 62,590,670 Q468R probably benign Het
Dlx6 A G 6: 6,863,423 D15G probably damaging Het
Dnajb14 T C 3: 137,904,797 V262A possibly damaging Het
Dpp7 A G 2: 25,355,591 V161A probably benign Het
Enkur C T 2: 21,205,102 S16N probably benign Het
Ensa C A 3: 95,628,645 H96Q probably damaging Het
Ero1lb T G 13: 12,602,365 C393G probably damaging Het
Fam173b C T 15: 31,606,040 A48V probably damaging Het
Fbxo3 T C 2: 104,051,198 F292L possibly damaging Het
Fos T C 12: 85,475,097 S102P probably benign Het
Foxs1 C T 2: 152,932,441 G231S probably benign Het
Furin T C 7: 80,396,986 D174G probably damaging Het
Gbp10 G A 5: 105,236,149 probably benign Het
Git2 C T 5: 114,766,489 R123H probably damaging Het
Gm32687 T A 10: 81,880,189 C472S probably damaging Het
Gmip A G 8: 69,814,435 E327G probably benign Het
Gpld1 A G 13: 24,962,405 T211A probably benign Het
Grin2d T C 7: 45,862,379 H214R probably benign Het
Hfm1 T C 5: 106,896,043 T576A probably benign Het
Hnrnpd A T 5: 99,967,254 F142I probably damaging Het
Krt32 T A 11: 100,081,221 T434S probably benign Het
Lct T G 1: 128,300,732 D1008A probably damaging Het
Man1c1 A G 4: 134,564,503 probably null Het
March7 T A 2: 60,229,704 C58* probably null Het
Mccc1 C T 3: 35,975,794 probably null Het
Mybpc1 T A 10: 88,549,325 D484V probably damaging Het
Myh10 T A 11: 68,745,980 C227S unknown Het
Nin T C 12: 70,062,706 E153G Het
Nr1h2 G A 7: 44,550,792 T313M probably damaging Het
Olfr1288 T A 2: 111,479,132 I116K probably damaging Het
Olfr178 G T 16: 58,889,266 A318D probably benign Het
Otog C A 7: 46,287,855 H1663N possibly damaging Het
Piezo2 G T 18: 63,053,010 T1696K probably benign Het
Plcd1 A T 9: 119,072,254 N703K possibly damaging Het
Plekhg4 T A 8: 105,375,399 C7S probably benign Het
Pnma2 A G 14: 66,915,979 probably benign Het
Prag1 A G 8: 36,146,942 Y1216C probably damaging Het
Prima1 T C 12: 103,197,307 Y135C probably damaging Het
Prkce C A 17: 86,493,293 S379* probably null Het
Prmt7 A G 8: 106,242,203 N383S probably damaging Het
Ptafr A G 4: 132,579,752 Y151C probably damaging Het
Ptprn2 T C 12: 116,485,866 M1T probably null Het
Rad23a A T 8: 84,838,479 S136T probably benign Het
Rnf123 A T 9: 108,070,619 Y137N probably damaging Het
Sfxn4 A C 19: 60,853,886 I126S probably benign Het
Slc4a4 A G 5: 89,225,867 H935R probably damaging Het
Slitrk3 T G 3: 73,051,115 N108T probably damaging Het
Spred1 T A 2: 117,177,325 H237Q probably benign Het
Syne1 T A 10: 5,124,820 K1168N probably damaging Het
Syt14 T C 1: 192,983,577 K340E unknown Het
Tespa1 T C 10: 130,354,755 S84P probably damaging Het
Tmem268 G T 4: 63,562,444 probably benign Het
Tmem52b T A 6: 129,516,077 Y48* probably null Het
Tox2 C A 2: 163,315,902 Y295* probably null Het
Trp53bp1 T G 2: 121,236,638 T536P possibly damaging Het
Tysnd1 T C 10: 61,695,886 C106R probably benign Het
Unc5d T C 8: 28,891,421 I63V probably damaging Het
Vmn1r235 A G 17: 21,261,619 N69D possibly damaging Het
Vps11 A T 9: 44,348,961 M868K probably benign Het
Wipf3 A G 6: 54,485,524 T240A possibly damaging Het
Xirp2 G A 2: 67,514,965 E2517K possibly damaging Het
Ylpm1 T A 12: 84,997,220 L244Q unknown Het
Zdhhc18 G T 4: 133,615,209 S198* probably null Het
Zfp760 T A 17: 21,722,261 L139* probably null Het
Other mutations in Fam129a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01150:Fam129a APN 1 151717721 missense probably benign 0.06
IGL01690:Fam129a APN 1 151703804 missense probably damaging 1.00
IGL01762:Fam129a APN 1 151636491 missense probably damaging 1.00
IGL01784:Fam129a APN 1 151649365 missense probably damaging 1.00
IGL01938:Fam129a APN 1 151689614 missense probably benign 0.22
IGL02427:Fam129a APN 1 151717274 missense probably damaging 1.00
IGL02617:Fam129a APN 1 151571545 missense probably benign 0.11
IGL02946:Fam129a APN 1 151649425 missense probably damaging 0.99
R0242:Fam129a UTSW 1 151718216 missense probably benign 0.00
R0242:Fam129a UTSW 1 151718216 missense probably benign 0.00
R0279:Fam129a UTSW 1 151709206 critical splice donor site probably null
R0421:Fam129a UTSW 1 151709082 splice site probably benign
R0531:Fam129a UTSW 1 151718084 missense probably benign 0.11
R0725:Fam129a UTSW 1 151706015 missense probably benign 0.04
R1493:Fam129a UTSW 1 151706090 missense probably damaging 1.00
R1563:Fam129a UTSW 1 151715673 missense possibly damaging 0.69
R1868:Fam129a UTSW 1 151641551 missense possibly damaging 0.71
R1944:Fam129a UTSW 1 151696228 missense probably damaging 0.99
R1945:Fam129a UTSW 1 151696228 missense probably damaging 0.99
R2071:Fam129a UTSW 1 151636430 missense probably damaging 1.00
R2126:Fam129a UTSW 1 151696135 missense probably damaging 1.00
R2126:Fam129a UTSW 1 151709133 missense possibly damaging 0.94
R2138:Fam129a UTSW 1 151696251 missense probably damaging 0.98
R2180:Fam129a UTSW 1 151718078 missense probably benign 0.02
R2402:Fam129a UTSW 1 151689614 missense probably benign 0.22
R3689:Fam129a UTSW 1 151703696 splice site probably null
R3783:Fam129a UTSW 1 151689648 missense possibly damaging 0.66
R3975:Fam129a UTSW 1 151649335 missense probably damaging 1.00
R4029:Fam129a UTSW 1 151695690 missense probably benign 0.00
R4328:Fam129a UTSW 1 151636418 missense possibly damaging 0.86
R4447:Fam129a UTSW 1 151636402 critical splice acceptor site probably null
R4573:Fam129a UTSW 1 151703766 missense possibly damaging 0.85
R4774:Fam129a UTSW 1 151715694 missense probably damaging 1.00
R5064:Fam129a UTSW 1 151689659 missense probably benign 0.05
R5077:Fam129a UTSW 1 151714523 missense probably benign 0.00
R5187:Fam129a UTSW 1 151703829 missense possibly damaging 0.50
R5484:Fam129a UTSW 1 151718086 missense probably benign 0.08
R5553:Fam129a UTSW 1 151717235 missense probably damaging 0.99
R5572:Fam129a UTSW 1 151709190 missense probably benign 0.05
R5575:Fam129a UTSW 1 151718240 missense probably benign 0.31
R5586:Fam129a UTSW 1 151717556 missense probably benign 0.00
R5697:Fam129a UTSW 1 151700261 missense probably damaging 1.00
R6305:Fam129a UTSW 1 151695718 missense probably damaging 1.00
R7065:Fam129a UTSW 1 151700107 critical splice acceptor site probably null
R7126:Fam129a UTSW 1 151714567 nonsense probably null
R7392:Fam129a UTSW 1 151696224 missense probably damaging 1.00
R7571:Fam129a UTSW 1 151718297 missense probably benign 0.01
R7939:Fam129a UTSW 1 151706024 missense probably damaging 1.00
R8018:Fam129a UTSW 1 151717255 nonsense probably null
R8164:Fam129a UTSW 1 151717588 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- TGCCACGTTAAGCTCTAACCC -3'
(R):5'- GCTCACACCCGCTAGACATTTC -3'

Sequencing Primer
(F):5'- CATCTGTCCCATGGAGAGCAATG -3'
(R):5'- ACCCGCTAGACATTTCCTCTGG -3'
Posted On2019-10-24