Incidental Mutation 'R7577:4931423N10Rik'
ID586471
Institutional Source Beutler Lab
Gene Symbol 4931423N10Rik
Ensembl Gene ENSMUSG00000026774
Gene NameRIKEN cDNA 4931423N10 gene
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.081) question?
Stock #R7577 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location23207476-23267129 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 23207825 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 5 (Y5C)
Ref Sequence ENSEMBL: ENSMUSP00000028113 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028113] [ENSMUST00000114505]
Predicted Effect probably benign
Transcript: ENSMUST00000028113
AA Change: Y5C

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000028113
Gene: ENSMUSG00000026774
AA Change: Y5C

DomainStartEndE-ValueType
Blast:ANK 62 92 7e-15 BLAST
ANK 96 125 6.71e-2 SMART
ANK 129 158 1.3e1 SMART
ANK 162 191 1.01e-5 SMART
ANK 195 224 2.88e-1 SMART
ANK 228 257 1.93e-2 SMART
ANK 261 290 1.09e3 SMART
low complexity region 341 352 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000114505
AA Change: Y5C

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000110150
Gene: ENSMUSG00000026774
AA Change: Y5C

DomainStartEndE-ValueType
Blast:ANK 62 92 4e-15 BLAST
ANK 96 125 6.71e-2 SMART
ANK 137 166 2.88e-1 SMART
ANK 170 199 1.93e-2 SMART
ANK 203 232 1.09e3 SMART
low complexity region 282 293 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610008E11Rik C T 10: 79,066,491 V664M possibly damaging Het
9530053A07Rik A G 7: 28,154,423 D1604G possibly damaging Het
Abca4 A G 3: 122,174,014 T2238A probably damaging Het
Adss G A 1: 177,767,697 Q426* probably null Het
Afap1l2 T C 19: 56,944,767 E71G probably damaging Het
Afg1l T C 10: 42,318,611 D395G probably damaging Het
Akap9 C G 5: 3,968,745 H1109D probably benign Het
Alms1 A G 6: 85,615,320 T385A probably benign Het
Ank3 C T 10: 69,992,572 T2357I Het
Ankfn1 T A 11: 89,503,971 S263C probably benign Het
Azin1 C T 15: 38,501,421 V29I probably benign Het
B3galt2 T C 1: 143,647,304 Y393H probably damaging Het
Cnbd2 G T 2: 156,328,376 R127L possibly damaging Het
Col6a5 A T 9: 105,864,688 L2344* probably null Het
Csn3 T C 5: 87,929,962 V109A not run Het
Cxcr2 C G 1: 74,158,915 N189K probably benign Het
Dclre1a A G 19: 56,529,533 F1038S probably damaging Het
Ddx21 T C 10: 62,590,670 Q468R probably benign Het
Dlx6 A G 6: 6,863,423 D15G probably damaging Het
Dnajb14 T C 3: 137,904,797 V262A possibly damaging Het
Dpp7 A G 2: 25,355,591 V161A probably benign Het
Enkur C T 2: 21,205,102 S16N probably benign Het
Ensa C A 3: 95,628,645 H96Q probably damaging Het
Ero1lb T G 13: 12,602,365 C393G probably damaging Het
Fam129a T A 1: 151,718,312 V916E probably benign Het
Fam173b C T 15: 31,606,040 A48V probably damaging Het
Fbxo3 T C 2: 104,051,198 F292L possibly damaging Het
Fos T C 12: 85,475,097 S102P probably benign Het
Foxs1 C T 2: 152,932,441 G231S probably benign Het
Furin T C 7: 80,396,986 D174G probably damaging Het
Gbp10 G A 5: 105,236,149 probably benign Het
Git2 C T 5: 114,766,489 R123H probably damaging Het
Gm32687 T A 10: 81,880,189 C472S probably damaging Het
Gmip A G 8: 69,814,435 E327G probably benign Het
Gpld1 A G 13: 24,962,405 T211A probably benign Het
Grin2d T C 7: 45,862,379 H214R probably benign Het
Hfm1 T C 5: 106,896,043 T576A probably benign Het
Hnrnpd A T 5: 99,967,254 F142I probably damaging Het
Krt32 T A 11: 100,081,221 T434S probably benign Het
Lct T G 1: 128,300,732 D1008A probably damaging Het
Man1c1 A G 4: 134,564,503 probably null Het
March7 T A 2: 60,229,704 C58* probably null Het
Mccc1 C T 3: 35,975,794 probably null Het
Mybpc1 T A 10: 88,549,325 D484V probably damaging Het
Myh10 T A 11: 68,745,980 C227S unknown Het
Nin T C 12: 70,062,706 E153G Het
Nr1h2 G A 7: 44,550,792 T313M probably damaging Het
Olfr1288 T A 2: 111,479,132 I116K probably damaging Het
Olfr178 G T 16: 58,889,266 A318D probably benign Het
Otog C A 7: 46,287,855 H1663N possibly damaging Het
Piezo2 G T 18: 63,053,010 T1696K probably benign Het
Plcd1 A T 9: 119,072,254 N703K possibly damaging Het
Plekhg4 T A 8: 105,375,399 C7S probably benign Het
Pnma2 A G 14: 66,915,979 probably benign Het
Prag1 A G 8: 36,146,942 Y1216C probably damaging Het
Prima1 T C 12: 103,197,307 Y135C probably damaging Het
Prkce C A 17: 86,493,293 S379* probably null Het
Prmt7 A G 8: 106,242,203 N383S probably damaging Het
Ptafr A G 4: 132,579,752 Y151C probably damaging Het
Ptprn2 T C 12: 116,485,866 M1T probably null Het
Rad23a A T 8: 84,838,479 S136T probably benign Het
Rnf123 A T 9: 108,070,619 Y137N probably damaging Het
Sfxn4 A C 19: 60,853,886 I126S probably benign Het
Slc4a4 A G 5: 89,225,867 H935R probably damaging Het
Slitrk3 T G 3: 73,051,115 N108T probably damaging Het
Spred1 T A 2: 117,177,325 H237Q probably benign Het
Syne1 T A 10: 5,124,820 K1168N probably damaging Het
Syt14 T C 1: 192,983,577 K340E unknown Het
Tespa1 T C 10: 130,354,755 S84P probably damaging Het
Tmem268 G T 4: 63,562,444 probably benign Het
Tmem52b T A 6: 129,516,077 Y48* probably null Het
Tox2 C A 2: 163,315,902 Y295* probably null Het
Trp53bp1 T G 2: 121,236,638 T536P possibly damaging Het
Tysnd1 T C 10: 61,695,886 C106R probably benign Het
Unc5d T C 8: 28,891,421 I63V probably damaging Het
Vmn1r235 A G 17: 21,261,619 N69D possibly damaging Het
Vps11 A T 9: 44,348,961 M868K probably benign Het
Wipf3 A G 6: 54,485,524 T240A possibly damaging Het
Xirp2 G A 2: 67,514,965 E2517K possibly damaging Het
Ylpm1 T A 12: 84,997,220 L244Q unknown Het
Zdhhc18 G T 4: 133,615,209 S198* probably null Het
Zfp760 T A 17: 21,722,261 L139* probably null Het
Other mutations in 4931423N10Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00694:4931423N10Rik APN 2 23230168 missense probably damaging 0.99
IGL02141:4931423N10Rik APN 2 23230200 missense probably damaging 1.00
IGL02377:4931423N10Rik APN 2 23212655 intron probably benign
IGL03328:4931423N10Rik APN 2 23212805 missense possibly damaging 0.71
R0467:4931423N10Rik UTSW 2 23212820 missense possibly damaging 0.85
R0723:4931423N10Rik UTSW 2 23256924 splice site probably benign
R1169:4931423N10Rik UTSW 2 23256982 missense possibly damaging 0.53
R1507:4931423N10Rik UTSW 2 23208074 missense probably damaging 0.98
R4965:4931423N10Rik UTSW 2 23245115 missense probably benign 0.40
R5198:4931423N10Rik UTSW 2 23212461 missense probably damaging 1.00
R5619:4931423N10Rik UTSW 2 23257005 critical splice donor site probably null
R5677:4931423N10Rik UTSW 2 23212718 missense probably damaging 0.98
R5715:4931423N10Rik UTSW 2 23207977 missense possibly damaging 0.86
R6123:4931423N10Rik UTSW 2 23230122 missense possibly damaging 0.93
R6263:4931423N10Rik UTSW 2 23266733 unclassified probably benign
R6858:4931423N10Rik UTSW 2 23212664 missense possibly damaging 0.51
R7427:4931423N10Rik UTSW 2 23256994 missense probably benign
Predicted Primers PCR Primer
(F):5'- TTGGCAAGCCTATGACAAGTG -3'
(R):5'- TTGTCAGGAAAGTAAGCCATGTC -3'

Sequencing Primer
(F):5'- AAGGATGAGTGGGCTTATTACATC -3'
(R):5'- GCCATGTCTAAATAAGCAGGATC -3'
Posted On2019-10-24