Incidental Mutation 'R7577:Slitrk3'
ID586483
Institutional Source Beutler Lab
Gene Symbol Slitrk3
Ensembl Gene ENSMUSG00000048304
Gene NameSLIT and NTRK-like family, member 3
Synonyms
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.798) question?
Stock #R7577 (G1)
Quality Score225.009
Status Not validated
Chromosome3
Chromosomal Location73047265-73057803 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 73051115 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Threonine at position 108 (N108T)
Ref Sequence ENSEMBL: ENSMUSP00000088561 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059407] [ENSMUST00000192477]
Predicted Effect probably damaging
Transcript: ENSMUST00000059407
AA Change: N108T

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000088561
Gene: ENSMUSG00000048304
AA Change: N108T

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
Blast:LRRNT 44 79 3e-11 BLAST
LRR 101 124 2.08e1 SMART
LRR 125 148 6.05e0 SMART
LRR 149 172 3.97e0 SMART
LRR_TYP 173 196 1.67e-2 SMART
LRR 197 220 2.69e2 SMART
LRRCT 233 283 4.56e-5 SMART
low complexity region 332 350 N/A INTRINSIC
LRRNT 373 411 4.17e0 SMART
LRR 432 455 1.62e0 SMART
LRR_TYP 456 479 2.61e-4 SMART
LRR 480 503 2.82e0 SMART
LRR_TYP 504 527 6.99e-5 SMART
LRRCT 563 613 3.22e-5 SMART
transmembrane domain 658 680 N/A INTRINSIC
low complexity region 713 724 N/A INTRINSIC
low complexity region 836 843 N/A INTRINSIC
low complexity region 846 858 N/A INTRINSIC
low complexity region 870 888 N/A INTRINSIC
Blast:LRRCT 906 943 2e-16 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000192477
AA Change: N108T

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000141236
Gene: ENSMUSG00000048304
AA Change: N108T

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
Blast:LRRNT 44 79 3e-11 BLAST
LRR 101 124 2.08e1 SMART
LRR 125 148 6.05e0 SMART
LRR 149 172 3.97e0 SMART
LRR_TYP 173 196 1.67e-2 SMART
LRR 197 220 2.69e2 SMART
LRRCT 233 283 4.56e-5 SMART
low complexity region 332 350 N/A INTRINSIC
LRRNT 373 411 4.17e0 SMART
LRR 432 455 1.62e0 SMART
LRR_TYP 456 479 2.61e-4 SMART
LRR 480 503 2.82e0 SMART
LRR_TYP 504 527 6.99e-5 SMART
LRRCT 563 613 3.22e-5 SMART
transmembrane domain 658 680 N/A INTRINSIC
low complexity region 713 724 N/A INTRINSIC
low complexity region 836 843 N/A INTRINSIC
low complexity region 846 858 N/A INTRINSIC
low complexity region 870 888 N/A INTRINSIC
Blast:LRRCT 906 943 2e-16 BLAST
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Slitrk family of structurally related transmembrane proteins that are involved in controlling neurite outgrowth. The encoded protein contains two leucine-rich repeat (LRR) domains and a C-terminal domain that is partially similar to Trk neurotrophin receptor protein. Enhanced expression of this gene was found in tissue from several different types of tumors. Alternative splicing results in multiple transcript variants, all encoding the same protein. [provided by RefSeq, Jan 2016]
PHENOTYPE: Mice homozygous for a knock-out mice exhibit reduced inhibitory synapse density, decreased miniature inhibitory postsynaptic current frequency and increased susceptibility to spontaneous and pharmacologically-induced seizures. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610008E11Rik C T 10: 79,066,491 V664M possibly damaging Het
4931423N10Rik A G 2: 23,207,825 Y5C probably benign Het
9530053A07Rik A G 7: 28,154,423 D1604G possibly damaging Het
Abca4 A G 3: 122,174,014 T2238A probably damaging Het
Adss G A 1: 177,767,697 Q426* probably null Het
Afap1l2 T C 19: 56,944,767 E71G probably damaging Het
Afg1l T C 10: 42,318,611 D395G probably damaging Het
Akap9 C G 5: 3,968,745 H1109D probably benign Het
Alms1 A G 6: 85,615,320 T385A probably benign Het
Ank3 C T 10: 69,992,572 T2357I Het
Ankfn1 T A 11: 89,503,971 S263C probably benign Het
Azin1 C T 15: 38,501,421 V29I probably benign Het
B3galt2 T C 1: 143,647,304 Y393H probably damaging Het
Cnbd2 G T 2: 156,328,376 R127L possibly damaging Het
Col6a5 A T 9: 105,864,688 L2344* probably null Het
Csn3 T C 5: 87,929,962 V109A not run Het
Cxcr2 C G 1: 74,158,915 N189K probably benign Het
Dclre1a A G 19: 56,529,533 F1038S probably damaging Het
Ddx21 T C 10: 62,590,670 Q468R probably benign Het
Dlx6 A G 6: 6,863,423 D15G probably damaging Het
Dnajb14 T C 3: 137,904,797 V262A possibly damaging Het
Dpp7 A G 2: 25,355,591 V161A probably benign Het
Enkur C T 2: 21,205,102 S16N probably benign Het
Ensa C A 3: 95,628,645 H96Q probably damaging Het
Ero1lb T G 13: 12,602,365 C393G probably damaging Het
Fam129a T A 1: 151,718,312 V916E probably benign Het
Fam173b C T 15: 31,606,040 A48V probably damaging Het
Fbxo3 T C 2: 104,051,198 F292L possibly damaging Het
Fos T C 12: 85,475,097 S102P probably benign Het
Foxs1 C T 2: 152,932,441 G231S probably benign Het
Furin T C 7: 80,396,986 D174G probably damaging Het
Gbp10 G A 5: 105,236,149 probably benign Het
Git2 C T 5: 114,766,489 R123H probably damaging Het
Gm32687 T A 10: 81,880,189 C472S probably damaging Het
Gmip A G 8: 69,814,435 E327G probably benign Het
Gpld1 A G 13: 24,962,405 T211A probably benign Het
Grin2d T C 7: 45,862,379 H214R probably benign Het
Hfm1 T C 5: 106,896,043 T576A probably benign Het
Hnrnpd A T 5: 99,967,254 F142I probably damaging Het
Krt32 T A 11: 100,081,221 T434S probably benign Het
Lct T G 1: 128,300,732 D1008A probably damaging Het
Man1c1 A G 4: 134,564,503 probably null Het
March7 T A 2: 60,229,704 C58* probably null Het
Mccc1 C T 3: 35,975,794 probably null Het
Mybpc1 T A 10: 88,549,325 D484V probably damaging Het
Myh10 T A 11: 68,745,980 C227S unknown Het
Nin T C 12: 70,062,706 E153G Het
Nr1h2 G A 7: 44,550,792 T313M probably damaging Het
Olfr1288 T A 2: 111,479,132 I116K probably damaging Het
Olfr178 G T 16: 58,889,266 A318D probably benign Het
Otog C A 7: 46,287,855 H1663N possibly damaging Het
Piezo2 G T 18: 63,053,010 T1696K probably benign Het
Plcd1 A T 9: 119,072,254 N703K possibly damaging Het
Plekhg4 T A 8: 105,375,399 C7S probably benign Het
Pnma2 A G 14: 66,915,979 probably benign Het
Prag1 A G 8: 36,146,942 Y1216C probably damaging Het
Prima1 T C 12: 103,197,307 Y135C probably damaging Het
Prkce C A 17: 86,493,293 S379* probably null Het
Prmt7 A G 8: 106,242,203 N383S probably damaging Het
Ptafr A G 4: 132,579,752 Y151C probably damaging Het
Ptprn2 T C 12: 116,485,866 M1T probably null Het
Rad23a A T 8: 84,838,479 S136T probably benign Het
Rnf123 A T 9: 108,070,619 Y137N probably damaging Het
Sfxn4 A C 19: 60,853,886 I126S probably benign Het
Slc4a4 A G 5: 89,225,867 H935R probably damaging Het
Spred1 T A 2: 117,177,325 H237Q probably benign Het
Syne1 T A 10: 5,124,820 K1168N probably damaging Het
Syt14 T C 1: 192,983,577 K340E unknown Het
Tespa1 T C 10: 130,354,755 S84P probably damaging Het
Tmem268 G T 4: 63,562,444 probably benign Het
Tmem52b T A 6: 129,516,077 Y48* probably null Het
Tox2 C A 2: 163,315,902 Y295* probably null Het
Trp53bp1 T G 2: 121,236,638 T536P possibly damaging Het
Tysnd1 T C 10: 61,695,886 C106R probably benign Het
Unc5d T C 8: 28,891,421 I63V probably damaging Het
Vmn1r235 A G 17: 21,261,619 N69D possibly damaging Het
Vps11 A T 9: 44,348,961 M868K probably benign Het
Wipf3 A G 6: 54,485,524 T240A possibly damaging Het
Xirp2 G A 2: 67,514,965 E2517K possibly damaging Het
Ylpm1 T A 12: 84,997,220 L244Q unknown Het
Zdhhc18 G T 4: 133,615,209 S198* probably null Het
Zfp760 T A 17: 21,722,261 L139* probably null Het
Other mutations in Slitrk3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00465:Slitrk3 APN 3 73051103 missense probably damaging 1.00
IGL00857:Slitrk3 APN 3 73049841 missense probably damaging 1.00
IGL00990:Slitrk3 APN 3 73050081 missense probably damaging 1.00
IGL01010:Slitrk3 APN 3 73049273 missense probably benign 0.14
IGL01299:Slitrk3 APN 3 73049016 missense probably benign 0.43
IGL01609:Slitrk3 APN 3 73050237 missense probably damaging 1.00
IGL01881:Slitrk3 APN 3 73049306 missense probably benign 0.00
IGL01941:Slitrk3 APN 3 73051071 missense possibly damaging 0.72
IGL02183:Slitrk3 APN 3 73049979 missense probably damaging 0.97
IGL02187:Slitrk3 APN 3 73050272 missense probably damaging 1.00
IGL02478:Slitrk3 APN 3 73050713 missense probably damaging 0.96
IGL02512:Slitrk3 APN 3 73050402 missense probably benign 0.28
IGL02720:Slitrk3 APN 3 73050768 missense probably damaging 1.00
IGL03113:Slitrk3 APN 3 73050390 missense probably benign 0.00
IGL03224:Slitrk3 APN 3 73049930 missense possibly damaging 0.72
wee UTSW 3 73050785 missense probably damaging 1.00
R0233:Slitrk3 UTSW 3 73048577 missense probably benign 0.00
R0233:Slitrk3 UTSW 3 73048577 missense probably benign 0.00
R0639:Slitrk3 UTSW 3 73049649 missense probably benign 0.02
R1448:Slitrk3 UTSW 3 73050341 missense probably damaging 0.99
R1656:Slitrk3 UTSW 3 73050339 missense probably damaging 0.98
R1713:Slitrk3 UTSW 3 73049691 missense probably benign 0.00
R1992:Slitrk3 UTSW 3 73049771 missense possibly damaging 0.80
R1999:Slitrk3 UTSW 3 73049964 missense probably benign 0.13
R2359:Slitrk3 UTSW 3 73049345 missense possibly damaging 0.56
R3083:Slitrk3 UTSW 3 73048595 missense probably benign 0.00
R3153:Slitrk3 UTSW 3 73048982 nonsense probably null
R3821:Slitrk3 UTSW 3 73049216 missense possibly damaging 0.94
R4208:Slitrk3 UTSW 3 73051157 missense possibly damaging 0.67
R4323:Slitrk3 UTSW 3 73050785 missense probably damaging 1.00
R4580:Slitrk3 UTSW 3 73051206 missense probably damaging 0.96
R4730:Slitrk3 UTSW 3 73049519 missense probably benign 0.08
R4742:Slitrk3 UTSW 3 73048565 missense probably benign 0.00
R4979:Slitrk3 UTSW 3 73049796 missense possibly damaging 0.95
R5018:Slitrk3 UTSW 3 73050512 missense probably benign 0.31
R5023:Slitrk3 UTSW 3 73050648 missense probably benign 0.24
R5057:Slitrk3 UTSW 3 73050648 missense probably benign 0.24
R5156:Slitrk3 UTSW 3 73049259 missense probably benign
R5500:Slitrk3 UTSW 3 73050347 missense probably damaging 1.00
R5582:Slitrk3 UTSW 3 73050404 missense probably benign 0.09
R5797:Slitrk3 UTSW 3 73048629 missense probably damaging 0.99
R5963:Slitrk3 UTSW 3 73050713 missense probably benign 0.30
R5985:Slitrk3 UTSW 3 73050900 missense probably damaging 1.00
R6123:Slitrk3 UTSW 3 73049762 missense probably damaging 1.00
R6393:Slitrk3 UTSW 3 73049914 missense possibly damaging 0.79
R6529:Slitrk3 UTSW 3 73051218 missense probably benign 0.02
R6584:Slitrk3 UTSW 3 73049225 missense probably damaging 0.99
R6645:Slitrk3 UTSW 3 73049861 missense probably benign 0.13
R7001:Slitrk3 UTSW 3 73050609 nonsense probably null
R7282:Slitrk3 UTSW 3 73050465 missense possibly damaging 0.70
R7534:Slitrk3 UTSW 3 73050107 missense probably damaging 0.98
R7757:Slitrk3 UTSW 3 73050839 missense probably damaging 1.00
X0022:Slitrk3 UTSW 3 73050266 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACTTAGGTTCCGAAATGCCCC -3'
(R):5'- AGATGAGCCCTGTTTTGATCCATG -3'

Sequencing Primer
(F):5'- GAAATGCCCCACTCTCTATACG -3'
(R):5'- TGATCCATGCTACTGCGAAG -3'
Posted On2019-10-24