Incidental Mutation 'R7577:Dnajb14'
ID586486
Institutional Source Beutler Lab
Gene Symbol Dnajb14
Ensembl Gene ENSMUSG00000074212
Gene NameDnaJ heat shock protein family (Hsp40) member B14
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.413) question?
Stock #R7577 (G1)
Quality Score225.009
Status Not validated
Chromosome3
Chromosomal Location137867675-137916557 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 137904797 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 262 (V262A)
Ref Sequence ENSEMBL: ENSMUSP00000087641 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090178] [ENSMUST00000197711]
Predicted Effect possibly damaging
Transcript: ENSMUST00000090178
AA Change: V262A

PolyPhen 2 Score 0.844 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000087641
Gene: ENSMUSG00000074212
AA Change: V262A

DomainStartEndE-ValueType
DnaJ 107 164 3.8e-28 SMART
low complexity region 226 242 N/A INTRINSIC
Pfam:DUF1977 265 371 1.1e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000197711
SMART Domains Protein: ENSMUSP00000143194
Gene: ENSMUSG00000074212

DomainStartEndE-ValueType
DnaJ 57 114 2.4e-30 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610008E11Rik C T 10: 79,066,491 V664M possibly damaging Het
4931423N10Rik A G 2: 23,207,825 Y5C probably benign Het
9530053A07Rik A G 7: 28,154,423 D1604G possibly damaging Het
Abca4 A G 3: 122,174,014 T2238A probably damaging Het
Adss G A 1: 177,767,697 Q426* probably null Het
Afap1l2 T C 19: 56,944,767 E71G probably damaging Het
Afg1l T C 10: 42,318,611 D395G probably damaging Het
Akap9 C G 5: 3,968,745 H1109D probably benign Het
Alms1 A G 6: 85,615,320 T385A probably benign Het
Ank3 C T 10: 69,992,572 T2357I Het
Ankfn1 T A 11: 89,503,971 S263C probably benign Het
Azin1 C T 15: 38,501,421 V29I probably benign Het
B3galt2 T C 1: 143,647,304 Y393H probably damaging Het
Cnbd2 G T 2: 156,328,376 R127L possibly damaging Het
Col6a5 A T 9: 105,864,688 L2344* probably null Het
Csn3 T C 5: 87,929,962 V109A not run Het
Cxcr2 C G 1: 74,158,915 N189K probably benign Het
Dclre1a A G 19: 56,529,533 F1038S probably damaging Het
Ddx21 T C 10: 62,590,670 Q468R probably benign Het
Dlx6 A G 6: 6,863,423 D15G probably damaging Het
Dpp7 A G 2: 25,355,591 V161A probably benign Het
Enkur C T 2: 21,205,102 S16N probably benign Het
Ensa C A 3: 95,628,645 H96Q probably damaging Het
Ero1lb T G 13: 12,602,365 C393G probably damaging Het
Fam129a T A 1: 151,718,312 V916E probably benign Het
Fam173b C T 15: 31,606,040 A48V probably damaging Het
Fbxo3 T C 2: 104,051,198 F292L possibly damaging Het
Fos T C 12: 85,475,097 S102P probably benign Het
Foxs1 C T 2: 152,932,441 G231S probably benign Het
Furin T C 7: 80,396,986 D174G probably damaging Het
Gbp10 G A 5: 105,236,149 probably benign Het
Git2 C T 5: 114,766,489 R123H probably damaging Het
Gm32687 T A 10: 81,880,189 C472S probably damaging Het
Gmip A G 8: 69,814,435 E327G probably benign Het
Gpld1 A G 13: 24,962,405 T211A probably benign Het
Grin2d T C 7: 45,862,379 H214R probably benign Het
Hfm1 T C 5: 106,896,043 T576A probably benign Het
Hnrnpd A T 5: 99,967,254 F142I probably damaging Het
Krt32 T A 11: 100,081,221 T434S probably benign Het
Lct T G 1: 128,300,732 D1008A probably damaging Het
Man1c1 A G 4: 134,564,503 probably null Het
March7 T A 2: 60,229,704 C58* probably null Het
Mccc1 C T 3: 35,975,794 probably null Het
Mybpc1 T A 10: 88,549,325 D484V probably damaging Het
Myh10 T A 11: 68,745,980 C227S unknown Het
Nin T C 12: 70,062,706 E153G Het
Nr1h2 G A 7: 44,550,792 T313M probably damaging Het
Olfr1288 T A 2: 111,479,132 I116K probably damaging Het
Olfr178 G T 16: 58,889,266 A318D probably benign Het
Otog C A 7: 46,287,855 H1663N possibly damaging Het
Piezo2 G T 18: 63,053,010 T1696K probably benign Het
Plcd1 A T 9: 119,072,254 N703K possibly damaging Het
Plekhg4 T A 8: 105,375,399 C7S probably benign Het
Pnma2 A G 14: 66,915,979 probably benign Het
Prag1 A G 8: 36,146,942 Y1216C probably damaging Het
Prima1 T C 12: 103,197,307 Y135C probably damaging Het
Prkce C A 17: 86,493,293 S379* probably null Het
Prmt7 A G 8: 106,242,203 N383S probably damaging Het
Ptafr A G 4: 132,579,752 Y151C probably damaging Het
Ptprn2 T C 12: 116,485,866 M1T probably null Het
Rad23a A T 8: 84,838,479 S136T probably benign Het
Rnf123 A T 9: 108,070,619 Y137N probably damaging Het
Sfxn4 A C 19: 60,853,886 I126S probably benign Het
Slc4a4 A G 5: 89,225,867 H935R probably damaging Het
Slitrk3 T G 3: 73,051,115 N108T probably damaging Het
Spred1 T A 2: 117,177,325 H237Q probably benign Het
Syne1 T A 10: 5,124,820 K1168N probably damaging Het
Syt14 T C 1: 192,983,577 K340E unknown Het
Tespa1 T C 10: 130,354,755 S84P probably damaging Het
Tmem268 G T 4: 63,562,444 probably benign Het
Tmem52b T A 6: 129,516,077 Y48* probably null Het
Tox2 C A 2: 163,315,902 Y295* probably null Het
Trp53bp1 T G 2: 121,236,638 T536P possibly damaging Het
Tysnd1 T C 10: 61,695,886 C106R probably benign Het
Unc5d T C 8: 28,891,421 I63V probably damaging Het
Vmn1r235 A G 17: 21,261,619 N69D possibly damaging Het
Vps11 A T 9: 44,348,961 M868K probably benign Het
Wipf3 A G 6: 54,485,524 T240A possibly damaging Het
Xirp2 G A 2: 67,514,965 E2517K possibly damaging Het
Ylpm1 T A 12: 84,997,220 L244Q unknown Het
Zdhhc18 G T 4: 133,615,209 S198* probably null Het
Zfp760 T A 17: 21,722,261 L139* probably null Het
Other mutations in Dnajb14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01743:Dnajb14 APN 3 137906000 missense possibly damaging 0.95
R1104:Dnajb14 UTSW 3 137908354 missense possibly damaging 0.75
R2271:Dnajb14 UTSW 3 137885380 missense probably benign
R2425:Dnajb14 UTSW 3 137892905 missense probably null 1.00
R3418:Dnajb14 UTSW 3 137892870 missense probably null 0.99
R3921:Dnajb14 UTSW 3 137904852 missense probably damaging 1.00
R4322:Dnajb14 UTSW 3 137885299 missense probably damaging 1.00
R5378:Dnajb14 UTSW 3 137885378 missense probably benign 0.01
R6256:Dnajb14 UTSW 3 137908362 missense probably damaging 1.00
R6256:Dnajb14 UTSW 3 137908363 missense probably damaging 1.00
X0028:Dnajb14 UTSW 3 137902302 missense probably benign 0.18
Predicted Primers PCR Primer
(F):5'- CAGGAGGTTGGGTTTATCCAGC -3'
(R):5'- CATCTCTTAAGCTGGCGGTTG -3'

Sequencing Primer
(F):5'- TATCCAGCAGGTTAGAAAGCTCTGC -3'
(R):5'- TAAGCTGGCGGTTGAACTCTCTAAC -3'
Posted On2019-10-24