Incidental Mutation 'R7577:Rnf123'
ID586515
Institutional Source Beutler Lab
Gene Symbol Rnf123
Ensembl Gene ENSMUSG00000041528
Gene Namering finger protein 123
SynonymsKPC1
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.257) question?
Stock #R7577 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location108051534-108083346 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 108070619 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Asparagine at position 137 (Y137N)
Ref Sequence ENSEMBL: ENSMUSP00000125745 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047746] [ENSMUST00000160249] [ENSMUST00000160649] [ENSMUST00000161828] [ENSMUST00000162355] [ENSMUST00000162516] [ENSMUST00000174504] [ENSMUST00000178267]
Predicted Effect probably damaging
Transcript: ENSMUST00000047746
AA Change: Y137N

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000040803
Gene: ENSMUSG00000041528
AA Change: Y137N

DomainStartEndE-ValueType
low complexity region 104 115 N/A INTRINSIC
SPRY 132 253 1.52e-28 SMART
low complexity region 471 488 N/A INTRINSIC
low complexity region 508 518 N/A INTRINSIC
coiled coil region 1047 1067 N/A INTRINSIC
low complexity region 1242 1251 N/A INTRINSIC
RING 1260 1297 5.27e-4 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000160249
AA Change: Y137N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000124548
Gene: ENSMUSG00000041528
AA Change: Y137N

DomainStartEndE-ValueType
low complexity region 104 115 N/A INTRINSIC
SPRY 132 253 1.52e-28 SMART
low complexity region 471 488 N/A INTRINSIC
low complexity region 508 518 N/A INTRINSIC
coiled coil region 1041 1061 N/A INTRINSIC
low complexity region 1236 1245 N/A INTRINSIC
RING 1254 1291 5.27e-4 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000160649
AA Change: Y137N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000125495
Gene: ENSMUSG00000041528
AA Change: Y137N

DomainStartEndE-ValueType
low complexity region 104 115 N/A INTRINSIC
SPRY 132 253 1.52e-28 SMART
low complexity region 471 488 N/A INTRINSIC
low complexity region 508 518 N/A INTRINSIC
coiled coil region 1041 1061 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000161828
Predicted Effect probably damaging
Transcript: ENSMUST00000162355
AA Change: Y137N

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000125745
Gene: ENSMUSG00000041528
AA Change: Y137N

DomainStartEndE-ValueType
low complexity region 104 115 N/A INTRINSIC
SPRY 132 253 1.52e-28 SMART
low complexity region 471 488 N/A INTRINSIC
low complexity region 508 518 N/A INTRINSIC
coiled coil region 1047 1067 N/A INTRINSIC
low complexity region 1242 1251 N/A INTRINSIC
RING 1260 1297 5.27e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000162516
Predicted Effect probably benign
Transcript: ENSMUST00000174504
Predicted Effect probably damaging
Transcript: ENSMUST00000178267
AA Change: Y137N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000136953
Gene: ENSMUSG00000041528
AA Change: Y137N

DomainStartEndE-ValueType
low complexity region 104 115 N/A INTRINSIC
SPRY 132 253 1.52e-28 SMART
low complexity region 471 488 N/A INTRINSIC
low complexity region 508 518 N/A INTRINSIC
coiled coil region 1041 1061 N/A INTRINSIC
low complexity region 1236 1245 N/A INTRINSIC
RING 1254 1291 5.27e-4 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains a C-terminal RING finger domain, a motif present in a variety of functionally distinct proteins and known to be involved in protein-protein and protein-DNA interactions, and an N-terminal SPRY domain. This protein displays E3 ubiquitin ligase activity toward the cyclin-dependent kinase inhibitor 1B which is also known as p27 or KIP1. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2016]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610008E11Rik C T 10: 79,066,491 V664M possibly damaging Het
4931423N10Rik A G 2: 23,207,825 Y5C probably benign Het
9530053A07Rik A G 7: 28,154,423 D1604G possibly damaging Het
Abca4 A G 3: 122,174,014 T2238A probably damaging Het
Adss G A 1: 177,767,697 Q426* probably null Het
Afap1l2 T C 19: 56,944,767 E71G probably damaging Het
Afg1l T C 10: 42,318,611 D395G probably damaging Het
Akap9 C G 5: 3,968,745 H1109D probably benign Het
Alms1 A G 6: 85,615,320 T385A probably benign Het
Ank3 C T 10: 69,992,572 T2357I Het
Ankfn1 T A 11: 89,503,971 S263C probably benign Het
Azin1 C T 15: 38,501,421 V29I probably benign Het
B3galt2 T C 1: 143,647,304 Y393H probably damaging Het
Cnbd2 G T 2: 156,328,376 R127L possibly damaging Het
Col6a5 A T 9: 105,864,688 L2344* probably null Het
Csn3 T C 5: 87,929,962 V109A not run Het
Cxcr2 C G 1: 74,158,915 N189K probably benign Het
Dclre1a A G 19: 56,529,533 F1038S probably damaging Het
Ddx21 T C 10: 62,590,670 Q468R probably benign Het
Dlx6 A G 6: 6,863,423 D15G probably damaging Het
Dnajb14 T C 3: 137,904,797 V262A possibly damaging Het
Dpp7 A G 2: 25,355,591 V161A probably benign Het
Enkur C T 2: 21,205,102 S16N probably benign Het
Ensa C A 3: 95,628,645 H96Q probably damaging Het
Ero1lb T G 13: 12,602,365 C393G probably damaging Het
Fam129a T A 1: 151,718,312 V916E probably benign Het
Fam173b C T 15: 31,606,040 A48V probably damaging Het
Fbxo3 T C 2: 104,051,198 F292L possibly damaging Het
Fos T C 12: 85,475,097 S102P probably benign Het
Foxs1 C T 2: 152,932,441 G231S probably benign Het
Furin T C 7: 80,396,986 D174G probably damaging Het
Gbp10 G A 5: 105,236,149 probably benign Het
Git2 C T 5: 114,766,489 R123H probably damaging Het
Gm32687 T A 10: 81,880,189 C472S probably damaging Het
Gmip A G 8: 69,814,435 E327G probably benign Het
Gpld1 A G 13: 24,962,405 T211A probably benign Het
Grin2d T C 7: 45,862,379 H214R probably benign Het
Hfm1 T C 5: 106,896,043 T576A probably benign Het
Hnrnpd A T 5: 99,967,254 F142I probably damaging Het
Krt32 T A 11: 100,081,221 T434S probably benign Het
Lct T G 1: 128,300,732 D1008A probably damaging Het
Man1c1 A G 4: 134,564,503 probably null Het
March7 T A 2: 60,229,704 C58* probably null Het
Mccc1 C T 3: 35,975,794 probably null Het
Mybpc1 T A 10: 88,549,325 D484V probably damaging Het
Myh10 T A 11: 68,745,980 C227S unknown Het
Nin T C 12: 70,062,706 E153G Het
Nr1h2 G A 7: 44,550,792 T313M probably damaging Het
Olfr1288 T A 2: 111,479,132 I116K probably damaging Het
Olfr178 G T 16: 58,889,266 A318D probably benign Het
Otog C A 7: 46,287,855 H1663N possibly damaging Het
Piezo2 G T 18: 63,053,010 T1696K probably benign Het
Plcd1 A T 9: 119,072,254 N703K possibly damaging Het
Plekhg4 T A 8: 105,375,399 C7S probably benign Het
Pnma2 A G 14: 66,915,979 probably benign Het
Prag1 A G 8: 36,146,942 Y1216C probably damaging Het
Prima1 T C 12: 103,197,307 Y135C probably damaging Het
Prkce C A 17: 86,493,293 S379* probably null Het
Prmt7 A G 8: 106,242,203 N383S probably damaging Het
Ptafr A G 4: 132,579,752 Y151C probably damaging Het
Ptprn2 T C 12: 116,485,866 M1T probably null Het
Rad23a A T 8: 84,838,479 S136T probably benign Het
Sfxn4 A C 19: 60,853,886 I126S probably benign Het
Slc4a4 A G 5: 89,225,867 H935R probably damaging Het
Slitrk3 T G 3: 73,051,115 N108T probably damaging Het
Spred1 T A 2: 117,177,325 H237Q probably benign Het
Syne1 T A 10: 5,124,820 K1168N probably damaging Het
Syt14 T C 1: 192,983,577 K340E unknown Het
Tespa1 T C 10: 130,354,755 S84P probably damaging Het
Tmem268 G T 4: 63,562,444 probably benign Het
Tmem52b T A 6: 129,516,077 Y48* probably null Het
Tox2 C A 2: 163,315,902 Y295* probably null Het
Trp53bp1 T G 2: 121,236,638 T536P possibly damaging Het
Tysnd1 T C 10: 61,695,886 C106R probably benign Het
Unc5d T C 8: 28,891,421 I63V probably damaging Het
Vmn1r235 A G 17: 21,261,619 N69D possibly damaging Het
Vps11 A T 9: 44,348,961 M868K probably benign Het
Wipf3 A G 6: 54,485,524 T240A possibly damaging Het
Xirp2 G A 2: 67,514,965 E2517K possibly damaging Het
Ylpm1 T A 12: 84,997,220 L244Q unknown Het
Zdhhc18 G T 4: 133,615,209 S198* probably null Het
Zfp760 T A 17: 21,722,261 L139* probably null Het
Other mutations in Rnf123
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00950:Rnf123 APN 9 108067395 critical splice donor site probably null
IGL01358:Rnf123 APN 9 108069182 missense probably damaging 1.00
IGL01464:Rnf123 APN 9 108052302 missense probably damaging 1.00
IGL01637:Rnf123 APN 9 108058238 missense probably damaging 1.00
IGL01669:Rnf123 APN 9 108058356 missense probably damaging 0.98
IGL01905:Rnf123 APN 9 108071370 splice site probably benign
IGL02070:Rnf123 APN 9 108068302 nonsense probably null
IGL02072:Rnf123 APN 9 108068302 nonsense probably null
IGL02073:Rnf123 APN 9 108068302 nonsense probably null
IGL02074:Rnf123 APN 9 108066889 missense probably damaging 1.00
IGL02079:Rnf123 APN 9 108068302 nonsense probably null
IGL02080:Rnf123 APN 9 108068302 nonsense probably null
IGL02231:Rnf123 APN 9 108066399 missense probably benign 0.17
IGL02281:Rnf123 APN 9 108071452 missense probably benign 0.01
IGL02336:Rnf123 APN 9 108061842 missense probably damaging 1.00
IGL02543:Rnf123 APN 9 108066348 missense probably damaging 1.00
IGL02565:Rnf123 APN 9 108052212 critical splice donor site probably null
IGL02571:Rnf123 APN 9 108068302 nonsense probably null
IGL02572:Rnf123 APN 9 108068302 nonsense probably null
IGL02574:Rnf123 APN 9 108068302 nonsense probably null
IGL02586:Rnf123 APN 9 108068302 nonsense probably null
IGL02589:Rnf123 APN 9 108068302 nonsense probably null
IGL02600:Rnf123 APN 9 108068302 nonsense probably null
IGL02601:Rnf123 APN 9 108068302 nonsense probably null
IGL02602:Rnf123 APN 9 108068302 nonsense probably null
IGL02603:Rnf123 APN 9 108068302 nonsense probably null
IGL02609:Rnf123 APN 9 108068302 nonsense probably null
IGL02628:Rnf123 APN 9 108068302 nonsense probably null
IGL02629:Rnf123 APN 9 108068302 nonsense probably null
IGL02629:Rnf123 APN 9 108070789 splice site probably benign
IGL02630:Rnf123 APN 9 108068302 nonsense probably null
IGL02631:Rnf123 APN 9 108068302 nonsense probably null
IGL02632:Rnf123 APN 9 108068302 nonsense probably null
IGL02650:Rnf123 APN 9 108069748 missense probably benign 0.29
IGL02690:Rnf123 APN 9 108068302 nonsense probably null
IGL02691:Rnf123 APN 9 108068302 nonsense probably null
IGL02692:Rnf123 APN 9 108068302 nonsense probably null
IGL02693:Rnf123 APN 9 108068302 nonsense probably null
IGL02713:Rnf123 APN 9 108068302 nonsense probably null
IGL02736:Rnf123 APN 9 108068302 nonsense probably null
IGL02929:Rnf123 APN 9 108069076 missense probably benign
R1175:Rnf123 UTSW 9 108077373 missense probably benign
R1465:Rnf123 UTSW 9 108071466 splice site probably benign
R1502:Rnf123 UTSW 9 108068510 splice site probably null
R1682:Rnf123 UTSW 9 108077398 missense probably benign 0.16
R1817:Rnf123 UTSW 9 108062926 missense probably benign 0.41
R1855:Rnf123 UTSW 9 108061791 missense probably damaging 1.00
R2394:Rnf123 UTSW 9 108063536 missense probably benign 0.00
R2483:Rnf123 UTSW 9 108063521 missense probably benign 0.16
R3896:Rnf123 UTSW 9 108069103 splice site probably benign
R3940:Rnf123 UTSW 9 108064035 splice site probably benign
R4206:Rnf123 UTSW 9 108063963 missense probably benign 0.01
R4641:Rnf123 UTSW 9 108058587 missense probably damaging 1.00
R4714:Rnf123 UTSW 9 108052439 splice site probably null
R4767:Rnf123 UTSW 9 108052089 missense probably damaging 1.00
R4849:Rnf123 UTSW 9 108056091 missense probably damaging 1.00
R4899:Rnf123 UTSW 9 108063680 missense probably damaging 1.00
R5274:Rnf123 UTSW 9 108064003 frame shift probably null
R5275:Rnf123 UTSW 9 108064003 frame shift probably null
R5276:Rnf123 UTSW 9 108064003 frame shift probably null
R5294:Rnf123 UTSW 9 108064003 frame shift probably null
R5295:Rnf123 UTSW 9 108064003 frame shift probably null
R5394:Rnf123 UTSW 9 108070731 missense probably damaging 1.00
R5717:Rnf123 UTSW 9 108067424 missense probably damaging 1.00
R6186:Rnf123 UTSW 9 108069958 missense possibly damaging 0.55
R6449:Rnf123 UTSW 9 108056053 missense probably benign 0.17
R6502:Rnf123 UTSW 9 108068332 missense possibly damaging 0.46
R6944:Rnf123 UTSW 9 108063623 missense probably benign 0.02
R7003:Rnf123 UTSW 9 108063683 critical splice acceptor site probably null
R7088:Rnf123 UTSW 9 108058536 missense probably null 1.00
R7092:Rnf123 UTSW 9 108068600 missense probably benign 0.07
R7100:Rnf123 UTSW 9 108056639 missense probably damaging 1.00
R7257:Rnf123 UTSW 9 108069029 missense probably damaging 1.00
R7453:Rnf123 UTSW 9 108070408 splice site probably null
R7468:Rnf123 UTSW 9 108069009 missense probably benign 0.00
R7517:Rnf123 UTSW 9 108070274 nonsense probably null
R8296:Rnf123 UTSW 9 108062890 missense probably damaging 1.00
R8322:Rnf123 UTSW 9 108068507 missense probably benign 0.26
Z1176:Rnf123 UTSW 9 108058395 missense probably damaging 1.00
Z1176:Rnf123 UTSW 9 108062981 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGAATGGGGCATAGTCCATCC -3'
(R):5'- TGTTCCTGGAGAGAAATACCAC -3'

Sequencing Primer
(F):5'- ATAGTCCATCCTCGGGGG -3'
(R):5'- CCTGGAGAGAAATACCACATTTTTC -3'
Posted On2019-10-24