Incidental Mutation 'R7577:Rnf123'
ID 586515
Institutional Source Beutler Lab
Gene Symbol Rnf123
Ensembl Gene ENSMUSG00000041528
Gene Name ring finger protein 123
Synonyms KPC1
MMRRC Submission 045662-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.163) question?
Stock # R7577 (G1)
Quality Score 225.009
Status Not validated
Chromosome 9
Chromosomal Location 107928869-107957183 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 107947818 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Asparagine at position 137 (Y137N)
Ref Sequence ENSEMBL: ENSMUSP00000125745 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047746] [ENSMUST00000160249] [ENSMUST00000160649] [ENSMUST00000161828] [ENSMUST00000162355] [ENSMUST00000162516] [ENSMUST00000174504] [ENSMUST00000178267]
AlphaFold Q5XPI3
Predicted Effect probably damaging
Transcript: ENSMUST00000047746
AA Change: Y137N

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000040803
Gene: ENSMUSG00000041528
AA Change: Y137N

DomainStartEndE-ValueType
low complexity region 104 115 N/A INTRINSIC
SPRY 132 253 1.52e-28 SMART
low complexity region 471 488 N/A INTRINSIC
low complexity region 508 518 N/A INTRINSIC
coiled coil region 1047 1067 N/A INTRINSIC
low complexity region 1242 1251 N/A INTRINSIC
RING 1260 1297 5.27e-4 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000160249
AA Change: Y137N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000124548
Gene: ENSMUSG00000041528
AA Change: Y137N

DomainStartEndE-ValueType
low complexity region 104 115 N/A INTRINSIC
SPRY 132 253 1.52e-28 SMART
low complexity region 471 488 N/A INTRINSIC
low complexity region 508 518 N/A INTRINSIC
coiled coil region 1041 1061 N/A INTRINSIC
low complexity region 1236 1245 N/A INTRINSIC
RING 1254 1291 5.27e-4 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000160649
AA Change: Y137N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000125495
Gene: ENSMUSG00000041528
AA Change: Y137N

DomainStartEndE-ValueType
low complexity region 104 115 N/A INTRINSIC
SPRY 132 253 1.52e-28 SMART
low complexity region 471 488 N/A INTRINSIC
low complexity region 508 518 N/A INTRINSIC
coiled coil region 1041 1061 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000161828
Predicted Effect probably damaging
Transcript: ENSMUST00000162355
AA Change: Y137N

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000125745
Gene: ENSMUSG00000041528
AA Change: Y137N

DomainStartEndE-ValueType
low complexity region 104 115 N/A INTRINSIC
SPRY 132 253 1.52e-28 SMART
low complexity region 471 488 N/A INTRINSIC
low complexity region 508 518 N/A INTRINSIC
coiled coil region 1047 1067 N/A INTRINSIC
low complexity region 1242 1251 N/A INTRINSIC
RING 1260 1297 5.27e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000162516
Predicted Effect probably benign
Transcript: ENSMUST00000174504
Predicted Effect probably damaging
Transcript: ENSMUST00000178267
AA Change: Y137N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000136953
Gene: ENSMUSG00000041528
AA Change: Y137N

DomainStartEndE-ValueType
low complexity region 104 115 N/A INTRINSIC
SPRY 132 253 1.52e-28 SMART
low complexity region 471 488 N/A INTRINSIC
low complexity region 508 518 N/A INTRINSIC
coiled coil region 1041 1061 N/A INTRINSIC
low complexity region 1236 1245 N/A INTRINSIC
RING 1254 1291 5.27e-4 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains a C-terminal RING finger domain, a motif present in a variety of functionally distinct proteins and known to be involved in protein-protein and protein-DNA interactions, and an N-terminal SPRY domain. This protein displays E3 ubiquitin ligase activity toward the cyclin-dependent kinase inhibitor 1B which is also known as p27 or KIP1. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2016]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610008E11Rik C T 10: 78,902,325 (GRCm39) V664M possibly damaging Het
Abca4 A G 3: 121,967,663 (GRCm39) T2238A probably damaging Het
Adss2 G A 1: 177,595,263 (GRCm39) Q426* probably null Het
Afap1l2 T C 19: 56,933,199 (GRCm39) E71G probably damaging Het
Afg1l T C 10: 42,194,607 (GRCm39) D395G probably damaging Het
Akap9 C G 5: 4,018,745 (GRCm39) H1109D probably benign Het
Alms1 A G 6: 85,592,302 (GRCm39) T385A probably benign Het
Ank3 C T 10: 69,828,402 (GRCm39) T2357I Het
Ankfn1 T A 11: 89,394,797 (GRCm39) S263C probably benign Het
Atpsckmt C T 15: 31,606,186 (GRCm39) A48V probably damaging Het
Azin1 C T 15: 38,501,665 (GRCm39) V29I probably benign Het
B3galt2 T C 1: 143,523,042 (GRCm39) Y393H probably damaging Het
Cnbd2 G T 2: 156,170,296 (GRCm39) R127L possibly damaging Het
Col6a5 A T 9: 105,741,887 (GRCm39) L2344* probably null Het
Csn3 T C 5: 88,077,821 (GRCm39) V109A not run Het
Cxcr2 C G 1: 74,198,074 (GRCm39) N189K probably benign Het
Dclre1a A G 19: 56,517,965 (GRCm39) F1038S probably damaging Het
Ddx21 T C 10: 62,426,449 (GRCm39) Q468R probably benign Het
Dlx6 A G 6: 6,863,423 (GRCm39) D15G probably damaging Het
Dnajb14 T C 3: 137,610,558 (GRCm39) V262A possibly damaging Het
Dpp7 A G 2: 25,245,603 (GRCm39) V161A probably benign Het
Enkur C T 2: 21,209,913 (GRCm39) S16N probably benign Het
Ensa C A 3: 95,535,956 (GRCm39) H96Q probably damaging Het
Ero1b T G 13: 12,617,254 (GRCm39) C393G probably damaging Het
Fbxo3 T C 2: 103,881,543 (GRCm39) F292L possibly damaging Het
Fcgbpl1 A G 7: 27,853,848 (GRCm39) D1604G possibly damaging Het
Fos T C 12: 85,521,871 (GRCm39) S102P probably benign Het
Foxs1 C T 2: 152,774,361 (GRCm39) G231S probably benign Het
Furin T C 7: 80,046,734 (GRCm39) D174G probably damaging Het
Gbp10 G A 5: 105,384,015 (GRCm39) probably benign Het
Git2 C T 5: 114,904,550 (GRCm39) R123H probably damaging Het
Gm32687 T A 10: 81,716,023 (GRCm39) C472S probably damaging Het
Gmip A G 8: 70,267,085 (GRCm39) E327G probably benign Het
Gpld1 A G 13: 25,146,388 (GRCm39) T211A probably benign Het
Grin2d T C 7: 45,511,803 (GRCm39) H214R probably benign Het
Hfm1 T C 5: 107,043,909 (GRCm39) T576A probably benign Het
Hnrnpd A T 5: 100,115,113 (GRCm39) F142I probably damaging Het
Krt32 T A 11: 99,972,047 (GRCm39) T434S probably benign Het
Lct T G 1: 128,228,469 (GRCm39) D1008A probably damaging Het
Man1c1 A G 4: 134,291,814 (GRCm39) probably null Het
Marchf7 T A 2: 60,060,048 (GRCm39) C58* probably null Het
Mccc1 C T 3: 36,029,943 (GRCm39) probably null Het
Mybpc1 T A 10: 88,385,187 (GRCm39) D484V probably damaging Het
Myh10 T A 11: 68,636,806 (GRCm39) C227S unknown Het
Niban1 T A 1: 151,594,063 (GRCm39) V916E probably benign Het
Nin T C 12: 70,109,480 (GRCm39) E153G Het
Nr1h2 G A 7: 44,200,216 (GRCm39) T313M probably damaging Het
Or4g7 T A 2: 111,309,477 (GRCm39) I116K probably damaging Het
Or5k15 G T 16: 58,709,629 (GRCm39) A318D probably benign Het
Otog C A 7: 45,937,279 (GRCm39) H1663N possibly damaging Het
Piezo2 G T 18: 63,186,081 (GRCm39) T1696K probably benign Het
Plcd1 A T 9: 118,901,322 (GRCm39) N703K possibly damaging Het
Plekhg4 T A 8: 106,102,031 (GRCm39) C7S probably benign Het
Pnma2 A G 14: 67,153,428 (GRCm39) probably benign Het
Potegl A G 2: 23,097,837 (GRCm39) Y5C probably benign Het
Prag1 A G 8: 36,614,096 (GRCm39) Y1216C probably damaging Het
Prima1 T C 12: 103,163,566 (GRCm39) Y135C probably damaging Het
Prkce C A 17: 86,800,721 (GRCm39) S379* probably null Het
Prmt7 A G 8: 106,968,835 (GRCm39) N383S probably damaging Het
Ptafr A G 4: 132,307,063 (GRCm39) Y151C probably damaging Het
Ptprn2 T C 12: 116,449,486 (GRCm39) M1T probably null Het
Rad23a A T 8: 85,565,108 (GRCm39) S136T probably benign Het
Sfxn4 A C 19: 60,842,324 (GRCm39) I126S probably benign Het
Slc4a4 A G 5: 89,373,726 (GRCm39) H935R probably damaging Het
Slitrk3 T G 3: 72,958,448 (GRCm39) N108T probably damaging Het
Spred1 T A 2: 117,007,806 (GRCm39) H237Q probably benign Het
Syne1 T A 10: 5,074,820 (GRCm39) K1168N probably damaging Het
Syt14 T C 1: 192,665,885 (GRCm39) K340E unknown Het
Tespa1 T C 10: 130,190,624 (GRCm39) S84P probably damaging Het
Tmem268 G T 4: 63,480,681 (GRCm39) probably benign Het
Tmem52b T A 6: 129,493,040 (GRCm39) Y48* probably null Het
Tox2 C A 2: 163,157,822 (GRCm39) Y295* probably null Het
Trp53bp1 T G 2: 121,067,119 (GRCm39) T536P possibly damaging Het
Tysnd1 T C 10: 61,531,665 (GRCm39) C106R probably benign Het
Unc5d T C 8: 29,381,449 (GRCm39) I63V probably damaging Het
Vmn1r235 A G 17: 21,481,881 (GRCm39) N69D possibly damaging Het
Vps11 A T 9: 44,260,258 (GRCm39) M868K probably benign Het
Wipf3 A G 6: 54,462,509 (GRCm39) T240A possibly damaging Het
Xirp2 G A 2: 67,345,309 (GRCm39) E2517K possibly damaging Het
Ylpm1 T A 12: 85,043,994 (GRCm39) L244Q unknown Het
Zdhhc18 G T 4: 133,342,520 (GRCm39) S198* probably null Het
Zfp760 T A 17: 21,941,242 (GRCm39) L139* probably null Het
Other mutations in Rnf123
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00950:Rnf123 APN 9 107,944,594 (GRCm39) critical splice donor site probably null
IGL01358:Rnf123 APN 9 107,946,381 (GRCm39) missense probably damaging 1.00
IGL01464:Rnf123 APN 9 107,929,501 (GRCm39) missense probably damaging 1.00
IGL01637:Rnf123 APN 9 107,935,437 (GRCm39) missense probably damaging 1.00
IGL01669:Rnf123 APN 9 107,935,555 (GRCm39) missense probably damaging 0.98
IGL01905:Rnf123 APN 9 107,948,569 (GRCm39) splice site probably benign
IGL02070:Rnf123 APN 9 107,945,501 (GRCm39) nonsense probably null
IGL02072:Rnf123 APN 9 107,945,501 (GRCm39) nonsense probably null
IGL02073:Rnf123 APN 9 107,945,501 (GRCm39) nonsense probably null
IGL02074:Rnf123 APN 9 107,944,088 (GRCm39) missense probably damaging 1.00
IGL02079:Rnf123 APN 9 107,945,501 (GRCm39) nonsense probably null
IGL02080:Rnf123 APN 9 107,945,501 (GRCm39) nonsense probably null
IGL02231:Rnf123 APN 9 107,943,598 (GRCm39) missense probably benign 0.17
IGL02281:Rnf123 APN 9 107,948,651 (GRCm39) missense probably benign 0.01
IGL02336:Rnf123 APN 9 107,939,041 (GRCm39) missense probably damaging 1.00
IGL02543:Rnf123 APN 9 107,943,547 (GRCm39) missense probably damaging 1.00
IGL02565:Rnf123 APN 9 107,929,411 (GRCm39) critical splice donor site probably null
IGL02571:Rnf123 APN 9 107,945,501 (GRCm39) nonsense probably null
IGL02572:Rnf123 APN 9 107,945,501 (GRCm39) nonsense probably null
IGL02574:Rnf123 APN 9 107,945,501 (GRCm39) nonsense probably null
IGL02586:Rnf123 APN 9 107,945,501 (GRCm39) nonsense probably null
IGL02589:Rnf123 APN 9 107,945,501 (GRCm39) nonsense probably null
IGL02600:Rnf123 APN 9 107,945,501 (GRCm39) nonsense probably null
IGL02601:Rnf123 APN 9 107,945,501 (GRCm39) nonsense probably null
IGL02602:Rnf123 APN 9 107,945,501 (GRCm39) nonsense probably null
IGL02603:Rnf123 APN 9 107,945,501 (GRCm39) nonsense probably null
IGL02609:Rnf123 APN 9 107,945,501 (GRCm39) nonsense probably null
IGL02628:Rnf123 APN 9 107,945,501 (GRCm39) nonsense probably null
IGL02629:Rnf123 APN 9 107,947,988 (GRCm39) splice site probably benign
IGL02629:Rnf123 APN 9 107,945,501 (GRCm39) nonsense probably null
IGL02630:Rnf123 APN 9 107,945,501 (GRCm39) nonsense probably null
IGL02631:Rnf123 APN 9 107,945,501 (GRCm39) nonsense probably null
IGL02632:Rnf123 APN 9 107,945,501 (GRCm39) nonsense probably null
IGL02650:Rnf123 APN 9 107,946,947 (GRCm39) missense probably benign 0.29
IGL02690:Rnf123 APN 9 107,945,501 (GRCm39) nonsense probably null
IGL02691:Rnf123 APN 9 107,945,501 (GRCm39) nonsense probably null
IGL02692:Rnf123 APN 9 107,945,501 (GRCm39) nonsense probably null
IGL02693:Rnf123 APN 9 107,945,501 (GRCm39) nonsense probably null
IGL02713:Rnf123 APN 9 107,945,501 (GRCm39) nonsense probably null
IGL02736:Rnf123 APN 9 107,945,501 (GRCm39) nonsense probably null
IGL02929:Rnf123 APN 9 107,946,275 (GRCm39) missense probably benign
R1175:Rnf123 UTSW 9 107,954,572 (GRCm39) missense probably benign
R1465:Rnf123 UTSW 9 107,948,665 (GRCm39) splice site probably benign
R1502:Rnf123 UTSW 9 107,945,709 (GRCm39) splice site probably null
R1682:Rnf123 UTSW 9 107,954,597 (GRCm39) missense probably benign 0.16
R1817:Rnf123 UTSW 9 107,940,125 (GRCm39) missense probably benign 0.41
R1855:Rnf123 UTSW 9 107,938,990 (GRCm39) missense probably damaging 1.00
R2394:Rnf123 UTSW 9 107,940,735 (GRCm39) missense probably benign 0.00
R2483:Rnf123 UTSW 9 107,940,720 (GRCm39) missense probably benign 0.16
R3896:Rnf123 UTSW 9 107,946,302 (GRCm39) splice site probably benign
R3940:Rnf123 UTSW 9 107,941,234 (GRCm39) splice site probably benign
R4206:Rnf123 UTSW 9 107,941,162 (GRCm39) missense probably benign 0.01
R4641:Rnf123 UTSW 9 107,935,786 (GRCm39) missense probably damaging 1.00
R4714:Rnf123 UTSW 9 107,929,638 (GRCm39) splice site probably null
R4767:Rnf123 UTSW 9 107,929,288 (GRCm39) missense probably damaging 1.00
R4849:Rnf123 UTSW 9 107,933,290 (GRCm39) missense probably damaging 1.00
R4899:Rnf123 UTSW 9 107,940,879 (GRCm39) missense probably damaging 1.00
R5274:Rnf123 UTSW 9 107,941,202 (GRCm39) frame shift probably null
R5275:Rnf123 UTSW 9 107,941,202 (GRCm39) frame shift probably null
R5276:Rnf123 UTSW 9 107,941,202 (GRCm39) frame shift probably null
R5294:Rnf123 UTSW 9 107,941,202 (GRCm39) frame shift probably null
R5295:Rnf123 UTSW 9 107,941,202 (GRCm39) frame shift probably null
R5394:Rnf123 UTSW 9 107,947,930 (GRCm39) missense probably damaging 1.00
R5717:Rnf123 UTSW 9 107,944,623 (GRCm39) missense probably damaging 1.00
R6186:Rnf123 UTSW 9 107,947,157 (GRCm39) missense possibly damaging 0.55
R6449:Rnf123 UTSW 9 107,933,252 (GRCm39) missense probably benign 0.17
R6502:Rnf123 UTSW 9 107,945,531 (GRCm39) missense possibly damaging 0.46
R6944:Rnf123 UTSW 9 107,940,822 (GRCm39) missense probably benign 0.02
R7003:Rnf123 UTSW 9 107,940,882 (GRCm39) critical splice acceptor site probably null
R7088:Rnf123 UTSW 9 107,935,735 (GRCm39) missense probably null 1.00
R7092:Rnf123 UTSW 9 107,945,799 (GRCm39) missense probably benign 0.07
R7100:Rnf123 UTSW 9 107,933,838 (GRCm39) missense probably damaging 1.00
R7257:Rnf123 UTSW 9 107,946,228 (GRCm39) missense probably damaging 1.00
R7453:Rnf123 UTSW 9 107,947,607 (GRCm39) splice site probably null
R7468:Rnf123 UTSW 9 107,946,208 (GRCm39) missense probably benign 0.00
R7517:Rnf123 UTSW 9 107,947,473 (GRCm39) nonsense probably null
R8296:Rnf123 UTSW 9 107,940,089 (GRCm39) missense probably damaging 1.00
R8322:Rnf123 UTSW 9 107,945,706 (GRCm39) missense probably benign 0.26
R8754:Rnf123 UTSW 9 107,948,363 (GRCm39) missense probably damaging 1.00
R8783:Rnf123 UTSW 9 107,946,272 (GRCm39) missense probably benign
R9052:Rnf123 UTSW 9 107,936,930 (GRCm39) missense probably damaging 1.00
R9156:Rnf123 UTSW 9 107,940,227 (GRCm39) splice site probably benign
R9170:Rnf123 UTSW 9 107,948,375 (GRCm39) missense probably damaging 1.00
R9332:Rnf123 UTSW 9 107,944,704 (GRCm39) missense probably benign 0.00
R9385:Rnf123 UTSW 9 107,929,467 (GRCm39) missense probably benign 0.02
R9394:Rnf123 UTSW 9 107,942,905 (GRCm39) missense probably damaging 1.00
R9432:Rnf123 UTSW 9 107,937,008 (GRCm39) missense probably damaging 0.96
R9717:Rnf123 UTSW 9 107,954,963 (GRCm39) missense probably benign 0.43
Z1176:Rnf123 UTSW 9 107,940,180 (GRCm39) missense probably damaging 1.00
Z1176:Rnf123 UTSW 9 107,935,594 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGAATGGGGCATAGTCCATCC -3'
(R):5'- TGTTCCTGGAGAGAAATACCAC -3'

Sequencing Primer
(F):5'- ATAGTCCATCCTCGGGGG -3'
(R):5'- CCTGGAGAGAAATACCACATTTTTC -3'
Posted On 2019-10-24