Mutagenetix > Incidental Mutation

Incidental Mutation 'R7577:Mybpc1'

586524

Institutional Source

Beutler Lab

Gene Symbol

Mybpc1

Ensembl Gene

ENSMUSG00000020061

Gene Name

myosin binding protein C, slow-type

Synonyms

8030451F13Rik, Slow-type C-protein

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.806) question?

Stock #

R7577 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

88518279-88605152 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 88549325 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Valine at position 484 (D484V)

Ref Sequence

ENSEMBL: ENSMUSP00000112699 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000119185] [ENSMUST00000121629]

AlphaFold

A0A571BEN1

Predicted Effect

probably damaging
Transcript: ENSMUST00000119185
AA Change: D484V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000112699
Gene: ENSMUSG00000020061
AA Change: D484V

Domain	Start	End	E-Value	Type
IG	51	147	1.96e-6	SMART
low complexity region	221	233	N/A	INTRINSIC
IG	246	325	4.53e-2	SMART
IG	335	416	1.13e-2	SMART
IG	426	506	6.97e-3	SMART
IG	519	604	2.83e-3	SMART
FN3	607	690	4.28e-10	SMART
FN3	705	788	1.49e-9	SMART
low complexity region	800	812	N/A	INTRINSIC
IG	815	898	9.06e-2	SMART
FN3	901	983	2.06e-12	SMART
IGc2	1028	1095	1.88e-8	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000121629
AA Change: D498V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000112615
Gene: ENSMUSG00000020061
AA Change: D498V

Domain	Start	End	E-Value	Type
low complexity region	8	27	N/A	INTRINSIC
IG	65	161	1.96e-6	SMART
low complexity region	235	247	N/A	INTRINSIC
IG	260	339	4.53e-2	SMART
IG	349	430	1.13e-2	SMART
IG	440	520	6.97e-3	SMART
IG	533	618	2.83e-3	SMART
FN3	621	704	4.28e-10	SMART
FN3	719	802	1.49e-9	SMART
low complexity region	814	826	N/A	INTRINSIC
IG	829	912	9.06e-2	SMART
FN3	915	997	2.06e-12	SMART
IGc2	1042	1109	1.88e-8	SMART

Predicted Effect

SMART Domains

Protein: ENSMUSP00000119024
Gene: ENSMUSG00000020061
AA Change: D123V

Domain	Start	End	E-Value	Type
PDB:1X44\|A	2	58	1e-26	PDB
IG	66	146	6.97e-3	SMART
IG	159	244	2.83e-3	SMART
FN3	247	330	4.28e-10	SMART
FN3	345	446	1.6e-9	SMART
low complexity region	458	470	N/A	INTRINSIC
IG	473	556	9.06e-2	SMART
FN3	559	617	8.17e0	SMART

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the myosin-binding protein C family. Myosin-binding protein C family members are myosin-associated proteins found in the cross-bridge-bearing zone (C region) of A bands in striated muscle. The encoded protein is the slow skeletal muscle isoform of myosin-binding protein C and plays an important role in muscle contraction by recruiting muscle-type creatine kinase to myosin filaments. Mutations in this gene are associated with distal arthrogryposis type I. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Dec 2011]

Allele List at MGI

Other mutations in this stock

Total: 82 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2610008E11Rik	C	T	10: 79,066,491	V664M	possibly damaging	Het
4931423N10Rik	A	G	2: 23,207,825	Y5C	probably benign	Het
9530053A07Rik	A	G	7: 28,154,423	D1604G	possibly damaging	Het
Abca4	A	G	3: 122,174,014	T2238A	probably damaging	Het
Adss	G	A	1: 177,767,697	Q426*	probably null	Het
Afap1l2	T	C	19: 56,944,767	E71G	probably damaging	Het
Afg1l	T	C	10: 42,318,611	D395G	probably damaging	Het
Akap9	C	G	5: 3,968,745	H1109D	probably benign	Het
Alms1	A	G	6: 85,615,320	T385A	probably benign	Het
Ank3	C	T	10: 69,992,572	T2357I		Het
Ankfn1	T	A	11: 89,503,971	S263C	probably benign	Het
Azin1	C	T	15: 38,501,421	V29I	probably benign	Het
B3galt2	T	C	1: 143,647,304	Y393H	probably damaging	Het
Cnbd2	G	T	2: 156,328,376	R127L	possibly damaging	Het
Col6a5	A	T	9: 105,864,688	L2344*	probably null	Het
Csn3	T	C	5: 87,929,962	V109A	not run	Het
Cxcr2	C	G	1: 74,158,915	N189K	probably benign	Het
Dclre1a	A	G	19: 56,529,533	F1038S	probably damaging	Het
Ddx21	T	C	10: 62,590,670	Q468R	probably benign	Het
Dlx6	A	G	6: 6,863,423	D15G	probably damaging	Het
Dnajb14	T	C	3: 137,904,797	V262A	possibly damaging	Het
Dpp7	A	G	2: 25,355,591	V161A	probably benign	Het
Enkur	C	T	2: 21,205,102	S16N	probably benign	Het
Ensa	C	A	3: 95,628,645	H96Q	probably damaging	Het
Ero1lb	T	G	13: 12,602,365	C393G	probably damaging	Het
Fam129a	T	A	1: 151,718,312	V916E	probably benign	Het
Fam173b	C	T	15: 31,606,040	A48V	probably damaging	Het
Fbxo3	T	C	2: 104,051,198	F292L	possibly damaging	Het
Fos	T	C	12: 85,475,097	S102P	probably benign	Het
Foxs1	C	T	2: 152,932,441	G231S	probably benign	Het
Furin	T	C	7: 80,396,986	D174G	probably damaging	Het
Gbp10	G	A	5: 105,236,149		probably benign	Het
Git2	C	T	5: 114,766,489	R123H	probably damaging	Het
Gm32687	T	A	10: 81,880,189	C472S	probably damaging	Het
Gmip	A	G	8: 69,814,435	E327G	probably benign	Het
Gpld1	A	G	13: 24,962,405	T211A	probably benign	Het
Grin2d	T	C	7: 45,862,379	H214R	probably benign	Het
Hfm1	T	C	5: 106,896,043	T576A	probably benign	Het
Hnrnpd	A	T	5: 99,967,254	F142I	probably damaging	Het
Krt32	T	A	11: 100,081,221	T434S	probably benign	Het
Lct	T	G	1: 128,300,732	D1008A	probably damaging	Het
Man1c1	A	G	4: 134,564,503		probably null	Het
March7	T	A	2: 60,229,704	C58*	probably null	Het
Mccc1	C	T	3: 35,975,794		probably null	Het
Myh10	T	A	11: 68,745,980	C227S	unknown	Het
Nin	T	C	12: 70,062,706	E153G		Het
Nr1h2	G	A	7: 44,550,792	T313M	probably damaging	Het
Olfr1288	T	A	2: 111,479,132	I116K	probably damaging	Het
Olfr178	G	T	16: 58,889,266	A318D	probably benign	Het
Otog	C	A	7: 46,287,855	H1663N	possibly damaging	Het
Piezo2	G	T	18: 63,053,010	T1696K	probably benign	Het
Plcd1	A	T	9: 119,072,254	N703K	possibly damaging	Het
Plekhg4	T	A	8: 105,375,399	C7S	probably benign	Het
Pnma2	A	G	14: 66,915,979		probably benign	Het
Prag1	A	G	8: 36,146,942	Y1216C	probably damaging	Het
Prima1	T	C	12: 103,197,307	Y135C	probably damaging	Het
Prkce	C	A	17: 86,493,293	S379*	probably null	Het
Prmt7	A	G	8: 106,242,203	N383S	probably damaging	Het
Ptafr	A	G	4: 132,579,752	Y151C	probably damaging	Het
Ptprn2	T	C	12: 116,485,866	M1T	probably null	Het
Rad23a	A	T	8: 84,838,479	S136T	probably benign	Het
Rnf123	A	T	9: 108,070,619	Y137N	probably damaging	Het
Sfxn4	A	C	19: 60,853,886	I126S	probably benign	Het
Slc4a4	A	G	5: 89,225,867	H935R	probably damaging	Het
Slitrk3	T	G	3: 73,051,115	N108T	probably damaging	Het
Spred1	T	A	2: 117,177,325	H237Q	probably benign	Het
Syne1	T	A	10: 5,124,820	K1168N	probably damaging	Het
Syt14	T	C	1: 192,983,577	K340E	unknown	Het
Tespa1	T	C	10: 130,354,755	S84P	probably damaging	Het
Tmem268	G	T	4: 63,562,444		probably benign	Het
Tmem52b	T	A	6: 129,516,077	Y48*	probably null	Het
Tox2	C	A	2: 163,315,902	Y295*	probably null	Het
Trp53bp1	T	G	2: 121,236,638	T536P	possibly damaging	Het
Tysnd1	T	C	10: 61,695,886	C106R	probably benign	Het
Unc5d	T	C	8: 28,891,421	I63V	probably damaging	Het
Vmn1r235	A	G	17: 21,261,619	N69D	possibly damaging	Het
Vps11	A	T	9: 44,348,961	M868K	probably benign	Het
Wipf3	A	G	6: 54,485,524	T240A	possibly damaging	Het
Xirp2	G	A	2: 67,514,965	E2517K	possibly damaging	Het
Ylpm1	T	A	12: 84,997,220	L244Q	unknown	Het
Zdhhc18	G	T	4: 133,615,209	S198*	probably null	Het
Zfp760	T	A	17: 21,722,261	L139*	probably null	Het

Other mutations in Mybpc1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00468:Mybpc1	APN	10	88549262	missense	probably damaging	0.98
IGL00577:Mybpc1	APN	10	88536384	missense	probably damaging	1.00
IGL00703:Mybpc1	APN	10	88525108	splice site	probably null
IGL00964:Mybpc1	APN	10	88555742	critical splice acceptor site	probably null
IGL01738:Mybpc1	APN	10	88570645	missense	probably damaging	1.00
IGL01978:Mybpc1	APN	10	88531770	missense	probably damaging	1.00
IGL02255:Mybpc1	APN	10	88536428	missense	probably damaging	1.00
IGL02997:Mybpc1	APN	10	88526373	missense	probably damaging	1.00
R0098:Mybpc1	UTSW	10	88529564	missense	probably benign	0.02
R0240:Mybpc1	UTSW	10	88555738	missense	possibly damaging	0.59
R0240:Mybpc1	UTSW	10	88555738	missense	possibly damaging	0.59
R0449:Mybpc1	UTSW	10	88540960	missense	probably damaging	1.00
R0879:Mybpc1	UTSW	10	88571516	splice site	probably benign
R1321:Mybpc1	UTSW	10	88529541	missense	possibly damaging	0.85
R1321:Mybpc1	UTSW	10	88570601	missense	probably damaging	1.00
R1562:Mybpc1	UTSW	10	88553331	missense	probably damaging	1.00
R1783:Mybpc1	UTSW	10	88570568	missense	probably damaging	1.00
R1803:Mybpc1	UTSW	10	88553295	missense	possibly damaging	0.65
R1962:Mybpc1	UTSW	10	88548826	missense	probably damaging	1.00
R1972:Mybpc1	UTSW	10	88551542	missense	probably benign	0.00
R2006:Mybpc1	UTSW	10	88546059	missense	probably damaging	0.99
R2125:Mybpc1	UTSW	10	88573437	nonsense	probably null
R2129:Mybpc1	UTSW	10	88551452	missense	probably damaging	1.00
R2163:Mybpc1	UTSW	10	88540942	splice site	probably benign
R2200:Mybpc1	UTSW	10	88555695	missense	probably damaging	1.00
R2219:Mybpc1	UTSW	10	88555678	missense	probably damaging	1.00
R2270:Mybpc1	UTSW	10	88551407	missense	probably benign	0.01
R2961:Mybpc1	UTSW	10	88531779	missense	probably damaging	1.00
R3767:Mybpc1	UTSW	10	88570659	splice site	probably null
R4032:Mybpc1	UTSW	10	88529564	missense	probably benign	0.02
R4226:Mybpc1	UTSW	10	88573525	nonsense	probably null
R4821:Mybpc1	UTSW	10	88548865	missense	probably damaging	0.98
R4876:Mybpc1	UTSW	10	88522991	missense	probably benign
R4876:Mybpc1	UTSW	10	88536424	missense	probably benign	0.03
R4878:Mybpc1	UTSW	10	88551430	missense	possibly damaging	0.95
R4910:Mybpc1	UTSW	10	88555724	nonsense	probably null
R4913:Mybpc1	UTSW	10	88553254	critical splice donor site	probably null
R4964:Mybpc1	UTSW	10	88555663	missense	probably benign	0.31
R5023:Mybpc1	UTSW	10	88543774	missense	probably damaging	1.00
R5098:Mybpc1	UTSW	10	88546064	missense	probably damaging	1.00
R5196:Mybpc1	UTSW	10	88536351	missense	probably damaging	0.97
R5344:Mybpc1	UTSW	10	88570568	missense	probably damaging	1.00
R5399:Mybpc1	UTSW	10	88523014	missense	probably damaging	1.00
R5538:Mybpc1	UTSW	10	88546029	missense	possibly damaging	0.89
R5808:Mybpc1	UTSW	10	88570566	missense	possibly damaging	0.83
R5970:Mybpc1	UTSW	10	88542456	missense	probably damaging	1.00
R6324:Mybpc1	UTSW	10	88568619	missense	possibly damaging	0.56
R6433:Mybpc1	UTSW	10	88560355	missense	probably damaging	1.00
R6441:Mybpc1	UTSW	10	88553277	missense	probably benign	0.09
R6648:Mybpc1	UTSW	10	88522999	missense	probably damaging	0.96
R6844:Mybpc1	UTSW	10	88536381	missense	possibly damaging	0.50
R6931:Mybpc1	UTSW	10	88542330	nonsense	probably null
R6972:Mybpc1	UTSW	10	88560361	missense	possibly damaging	0.50
R6973:Mybpc1	UTSW	10	88560361	missense	possibly damaging	0.50
R6978:Mybpc1	UTSW	10	88523024	missense	probably damaging	1.00
R7007:Mybpc1	UTSW	10	88553412	missense	probably damaging	1.00
R7019:Mybpc1	UTSW	10	88543719	missense	probably damaging	1.00
R7407:Mybpc1	UTSW	10	88549347	missense	probably damaging	0.99
R7442:Mybpc1	UTSW	10	88526293	missense	probably damaging	1.00
R7660:Mybpc1	UTSW	10	88548854	missense	possibly damaging	0.51
R7768:Mybpc1	UTSW	10	88542372	missense	probably damaging	1.00
R7818:Mybpc1	UTSW	10	88558667	missense	probably damaging	1.00
R8171:Mybpc1	UTSW	10	88523003	missense	probably damaging	1.00
R8195:Mybpc1	UTSW	10	88558691	missense	possibly damaging	0.47
R8241:Mybpc1	UTSW	10	88536424	missense	probably benign	0.03
R8360:Mybpc1	UTSW	10	88573497	nonsense	probably null
R8494:Mybpc1	UTSW	10	88526429	missense	probably benign	0.01
R8849:Mybpc1	UTSW	10	88571585	missense	probably benign	0.01
R8936:Mybpc1	UTSW	10	88558575	missense	probably benign	0.44
R9031:Mybpc1	UTSW	10	88523044	missense	probably damaging	0.99
R9061:Mybpc1	UTSW	10	88555639	missense	probably damaging	1.00
R9081:Mybpc1	UTSW	10	88553306	missense	probably damaging	1.00
R9172:Mybpc1	UTSW	10	88543753	missense	possibly damaging	0.93
R9323:Mybpc1	UTSW	10	88524967	critical splice donor site	probably null
R9460:Mybpc1	UTSW	10	88536335	missense	probably damaging	0.99
R9488:Mybpc1	UTSW	10	88543762	missense	possibly damaging	0.47
R9757:Mybpc1	UTSW	10	88536395	missense	probably damaging	1.00
R9796:Mybpc1	UTSW	10	88570635	missense	possibly damaging	0.56
Z1176:Mybpc1	UTSW	10	88560327	missense	probably benign
Z1177:Mybpc1	UTSW	10	88573437	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- GGTACCCTAGAAAACTGCTTCTTG -3'
(R):5'- CGAAACCACATCTGACTTGGG -3'

Sequencing Primer
(F):5'- ACCCTAGAAAACTGCTTCTTGTCATG -3'
(R):5'- CTTGGGTCAATGAATATAGTAACACC -3'

Posted On

2019-10-24