Incidental Mutation 'R7578:Ebf3'
ID586584
Institutional Source Beutler Lab
Gene Symbol Ebf3
Ensembl Gene ENSMUSG00000010476
Gene Nameearly B cell factor 3
SynonymsOlf-1/EBF-like 2, O/E-2, 3110018A08Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7578 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location137193673-137314445 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 137313532 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 93 (V93M)
Ref Sequence ENSEMBL: ENSMUSP00000147829 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033378] [ENSMUST00000106118] [ENSMUST00000168203] [ENSMUST00000169486] [ENSMUST00000210774]
Predicted Effect probably damaging
Transcript: ENSMUST00000033378
AA Change: V93M

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000033378
Gene: ENSMUSG00000010476
AA Change: V93M

DomainStartEndE-ValueType
low complexity region 94 106 N/A INTRINSIC
IPT 253 337 2.09e-7 SMART
HLH 338 387 1.43e-1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000106118
AA Change: V93M

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000101724
Gene: ENSMUSG00000010476
AA Change: V93M

DomainStartEndE-ValueType
Pfam:COE1_DBD 17 247 2.6e-151 PFAM
IPT 262 346 2.09e-7 SMART
HLH 347 396 1.43e-1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000168203
AA Change: V93M

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000130334
Gene: ENSMUSG00000010476
AA Change: V93M

DomainStartEndE-ValueType
low complexity region 94 106 N/A INTRINSIC
IPT 253 337 2.09e-7 SMART
HLH 338 387 1.43e-1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000169486
AA Change: V93M

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000132563
Gene: ENSMUSG00000010476
AA Change: V93M

DomainStartEndE-ValueType
low complexity region 94 106 N/A INTRINSIC
IPT 253 337 2.09e-7 SMART
HLH 338 387 1.43e-1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000210774
AA Change: V93M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.5645 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 97% (66/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the early B-cell factor (EBF) family of DNA binding transcription factors. EBF proteins are involved in B-cell differentiation, bone development and neurogenesis, and may also function as tumor suppressors. The encoded protein inhibits cell survival through the regulation of genes involved in cell cycle arrest and apoptosis, and aberrant methylation or deletion of this gene may play a role in multiple malignancies including glioblastoma multiforme and gastric carcinoma. [provided by RefSeq, Sep 2011]
PHENOTYPE: Homozygous mutant mice die perinatally and exhibit impaired olfactory neuron projection. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001J03Rik A T 5: 146,183,533 V165E probably damaging Het
1700025G04Rik T G 1: 151,921,090 T75P probably benign Het
4930516K23Rik T C 7: 104,058,897 E235G probably benign Het
Adam15 A G 3: 89,344,192 C449R probably damaging Het
Adam24 T C 8: 40,680,255 V254A probably benign Het
Akap9 C G 5: 3,968,745 H1109D probably benign Het
Aldh1a1 A C 19: 20,618,002 R98S probably damaging Het
Alg9 A G 9: 50,789,535 I202V probably benign Het
Anks1b G A 10: 90,049,927 E162K probably damaging Het
Armc4 A T 18: 7,211,593 D760E probably benign Het
Atp6v1b2 A G 8: 69,103,476 T268A probably benign Het
Atxn1 C T 13: 45,567,358 V354I probably benign Het
B3galt1 A G 2: 68,118,552 T204A probably damaging Het
Catsperb T A 12: 101,588,285 I746K probably benign Het
Cdh23 G A 10: 60,407,407 T1063M probably benign Het
Cherp G A 8: 72,464,258 R543C Het
Cldn20 A G 17: 3,532,999 D149G probably damaging Het
Clk2 A G 3: 89,176,500 Q474R probably benign Het
Cp A G 3: 19,989,098 T1017A possibly damaging Het
Cyp2c39 T C 19: 39,510,956 L29P probably damaging Het
Dscr3 A C 16: 94,499,069 N275K probably damaging Het
Eef1akmt1 T A 14: 57,549,871 M183L probably damaging Het
Fam160a1 G T 3: 85,665,898 L915I probably damaging Het
Fam71d T C 12: 78,715,501 probably null Het
Filip1l A G 16: 57,513,282 E146G probably damaging Het
Fpr-rs3 T C 17: 20,624,031 S283G possibly damaging Het
Fras1 A T 5: 96,684,437 Y1543F probably damaging Het
Gbp10 G A 5: 105,236,149 probably benign Het
Gjd3 A G 11: 98,982,475 V181A probably damaging Het
Gm49368 T A 7: 128,112,258 C711* probably null Het
Gtf3c2 A G 5: 31,172,997 S210P probably benign Het
Herc2 A G 7: 56,134,800 Y1404C probably benign Het
Il22ra2 T A 10: 19,631,624 D128E probably benign Het
Itgav T A 2: 83,747,875 D113E probably benign Het
Kcnd3 A G 3: 105,459,617 M268V probably benign Het
Kirrel3 G T 9: 34,939,112 G19V probably damaging Het
Klf17 T G 4: 117,760,719 Y147S possibly damaging Het
Leng1 C T 7: 3,665,383 R22H probably damaging Het
Lysmd4 T A 7: 67,226,289 Y233* probably null Het
Lyzl6 A G 11: 103,635,006 V96A probably benign Het
Mki67 T C 7: 135,700,915 T797A possibly damaging Het
Nuf2 G T 1: 169,504,528 H399Q probably benign Het
Nuggc T C 14: 65,648,174 V766A probably damaging Het
Oas1c A T 5: 120,802,179 D307E probably damaging Het
Olfr432 T A 1: 174,050,700 M109K possibly damaging Het
Olfr785 T C 10: 129,409,675 I103T probably damaging Het
P4ha3 T C 7: 100,293,914 Y169H probably benign Het
Perm1 TGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCT TGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCT 4: 156,218,068 probably benign Het
Pkhd1 T C 1: 20,347,361 D2522G probably damaging Het
Prickle2 T C 6: 92,411,290 D433G probably benign Het
Ptcd3 A G 6: 71,908,707 S12P probably benign Het
Ptpn23 T A 9: 110,387,608 Q1060L probably benign Het
Rai14 G T 15: 10,574,828 N710K probably benign Het
Rai14 C T 15: 10,593,103 G152R probably damaging Het
Rsf1 CGGC CGGCGGCGGGGGC 7: 97,579,932 probably benign Het
Satb2 A G 1: 56,871,784 V234A probably benign Het
Scg2 T C 1: 79,436,895 Q37R probably damaging Het
Slc35e3 A T 10: 117,740,579 S230T probably damaging Het
Slc39a2 T C 14: 51,895,416 V272A probably damaging Het
Smg7 T A 1: 152,845,430 Y677F probably damaging Het
Spinkl A G 18: 44,168,146 Y42H probably damaging Het
Srsf6 T C 2: 162,932,862 F102L probably benign Het
Sstr3 T C 15: 78,540,517 E10G probably benign Het
Tekt3 A T 11: 63,094,660 I431F probably damaging Het
Trio C T 15: 27,854,939 R778H possibly damaging Het
Ush2a T A 1: 188,549,913 V1875D probably damaging Het
Vmn2r29 A C 7: 7,231,442 I815S probably damaging Het
Vmn2r78 A T 7: 86,954,344 K577* probably null Het
Yes1 G A 5: 32,645,086 R115Q probably benign Het
Other mutations in Ebf3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01081:Ebf3 APN 7 137225896 splice site probably benign
IGL01938:Ebf3 APN 7 137309318 missense probably damaging 1.00
IGL02076:Ebf3 APN 7 137231301 missense possibly damaging 0.61
IGL02260:Ebf3 APN 7 137206190 missense probably damaging 1.00
IGL02303:Ebf3 APN 7 137309365 missense probably benign 0.01
IGL02828:Ebf3 APN 7 137307518 missense probably damaging 0.98
IGL03211:Ebf3 APN 7 137231304 missense probably benign 0.21
R0885:Ebf3 UTSW 7 137225884 missense probably benign 0.10
R0962:Ebf3 UTSW 7 137225203 missense probably damaging 0.99
R1166:Ebf3 UTSW 7 137313167 splice site probably benign
R1255:Ebf3 UTSW 7 137225212 missense probably benign 0.35
R1804:Ebf3 UTSW 7 137200521 missense possibly damaging 0.89
R4298:Ebf3 UTSW 7 137225229 missense possibly damaging 0.95
R4393:Ebf3 UTSW 7 137225157 missense probably damaging 0.99
R5061:Ebf3 UTSW 7 137313559 missense possibly damaging 0.57
R5880:Ebf3 UTSW 7 137198638 missense probably benign 0.04
R6024:Ebf3 UTSW 7 137200535 missense probably damaging 1.00
R6109:Ebf3 UTSW 7 137206226 missense probably damaging 1.00
R6634:Ebf3 UTSW 7 137201160 missense probably damaging 0.99
R6958:Ebf3 UTSW 7 137199265 missense possibly damaging 0.66
R6997:Ebf3 UTSW 7 137225265 missense probably damaging 0.97
R7771:Ebf3 UTSW 7 137309363 missense probably damaging 1.00
R8133:Ebf3 UTSW 7 137313143 missense probably damaging 1.00
R8185:Ebf3 UTSW 7 137225878 missense possibly damaging 0.87
RF022:Ebf3 UTSW 7 137313942 start gained probably benign
Predicted Primers PCR Primer
(F):5'- AGAAGTTGTTCGGCCCTTG -3'
(R):5'- TCAGGAGAATATTCCGCGC -3'

Sequencing Primer
(F):5'- ACTCGGACCCCATGCGCGGGCACCAA -3'
(R):5'- AGAATATTCCGCGCGGGGG -3'
Posted On2019-10-24