Incidental Mutation 'R7578:Alg9'
ID586589
Institutional Source Beutler Lab
Gene Symbol Alg9
Ensembl Gene ENSMUSG00000032059
Gene Nameasparagine-linked glycosylation 9 (alpha 1,2 mannosyltransferase)
SynonymsB430313H07Rik, 8230402H15Rik, Dibd1
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7578 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location50775019-50843542 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 50789535 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 202 (I202V)
Ref Sequence ENSEMBL: ENSMUSP00000034561 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034561] [ENSMUST00000159576] [ENSMUST00000162073]
Predicted Effect probably benign
Transcript: ENSMUST00000034561
AA Change: I202V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000034561
Gene: ENSMUSG00000032059
AA Change: I202V

DomainStartEndE-ValueType
Pfam:Glyco_transf_22 60 482 3.5e-127 PFAM
low complexity region 598 611 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000159576
SMART Domains Protein: ENSMUSP00000123711
Gene: ENSMUSG00000032059

DomainStartEndE-ValueType
Pfam:Glyco_transf_22 60 228 1e-43 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000162073
AA Change: D178G
SMART Domains Protein: ENSMUSP00000125425
Gene: ENSMUSG00000032059
AA Change: D178G

DomainStartEndE-ValueType
Pfam:Glyco_transf_22 60 167 7.5e-31 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 97% (66/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an alpha-1,2-mannosyltransferase enzyme that functions in lipid-linked oligosaccharide assembly. Mutations in this gene result in congenital disorder of glycosylation type Il. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2008]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001J03Rik A T 5: 146,183,533 V165E probably damaging Het
1700025G04Rik T G 1: 151,921,090 T75P probably benign Het
4930516K23Rik T C 7: 104,058,897 E235G probably benign Het
Adam15 A G 3: 89,344,192 C449R probably damaging Het
Adam24 T C 8: 40,680,255 V254A probably benign Het
Akap9 C G 5: 3,968,745 H1109D probably benign Het
Aldh1a1 A C 19: 20,618,002 R98S probably damaging Het
Anks1b G A 10: 90,049,927 E162K probably damaging Het
Armc4 A T 18: 7,211,593 D760E probably benign Het
Atp6v1b2 A G 8: 69,103,476 T268A probably benign Het
Atxn1 C T 13: 45,567,358 V354I probably benign Het
B3galt1 A G 2: 68,118,552 T204A probably damaging Het
Catsperb T A 12: 101,588,285 I746K probably benign Het
Cdh23 G A 10: 60,407,407 T1063M probably benign Het
Cherp G A 8: 72,464,258 R543C Het
Cldn20 A G 17: 3,532,999 D149G probably damaging Het
Clk2 A G 3: 89,176,500 Q474R probably benign Het
Cp A G 3: 19,989,098 T1017A possibly damaging Het
Cyp2c39 T C 19: 39,510,956 L29P probably damaging Het
Dscr3 A C 16: 94,499,069 N275K probably damaging Het
Ebf3 C T 7: 137,313,532 V93M probably damaging Het
Eef1akmt1 T A 14: 57,549,871 M183L probably damaging Het
Fam160a1 G T 3: 85,665,898 L915I probably damaging Het
Fam71d T C 12: 78,715,501 probably null Het
Filip1l A G 16: 57,513,282 E146G probably damaging Het
Fpr-rs3 T C 17: 20,624,031 S283G possibly damaging Het
Fras1 A T 5: 96,684,437 Y1543F probably damaging Het
Gbp10 G A 5: 105,236,149 probably benign Het
Gjd3 A G 11: 98,982,475 V181A probably damaging Het
Gm49368 T A 7: 128,112,258 C711* probably null Het
Gtf3c2 A G 5: 31,172,997 S210P probably benign Het
Herc2 A G 7: 56,134,800 Y1404C probably benign Het
Il22ra2 T A 10: 19,631,624 D128E probably benign Het
Itgav T A 2: 83,747,875 D113E probably benign Het
Kcnd3 A G 3: 105,459,617 M268V probably benign Het
Kirrel3 G T 9: 34,939,112 G19V probably damaging Het
Klf17 T G 4: 117,760,719 Y147S possibly damaging Het
Leng1 C T 7: 3,665,383 R22H probably damaging Het
Lysmd4 T A 7: 67,226,289 Y233* probably null Het
Lyzl6 A G 11: 103,635,006 V96A probably benign Het
Mki67 T C 7: 135,700,915 T797A possibly damaging Het
Nuf2 G T 1: 169,504,528 H399Q probably benign Het
Nuggc T C 14: 65,648,174 V766A probably damaging Het
Oas1c A T 5: 120,802,179 D307E probably damaging Het
Olfr432 T A 1: 174,050,700 M109K possibly damaging Het
Olfr785 T C 10: 129,409,675 I103T probably damaging Het
P4ha3 T C 7: 100,293,914 Y169H probably benign Het
Perm1 TGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCT TGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCT 4: 156,218,068 probably benign Het
Pkhd1 T C 1: 20,347,361 D2522G probably damaging Het
Prickle2 T C 6: 92,411,290 D433G probably benign Het
Ptcd3 A G 6: 71,908,707 S12P probably benign Het
Ptpn23 T A 9: 110,387,608 Q1060L probably benign Het
Rai14 G T 15: 10,574,828 N710K probably benign Het
Rai14 C T 15: 10,593,103 G152R probably damaging Het
Rsf1 CGGC CGGCGGCGGGGGC 7: 97,579,932 probably benign Het
Satb2 A G 1: 56,871,784 V234A probably benign Het
Scg2 T C 1: 79,436,895 Q37R probably damaging Het
Slc35e3 A T 10: 117,740,579 S230T probably damaging Het
Slc39a2 T C 14: 51,895,416 V272A probably damaging Het
Smg7 T A 1: 152,845,430 Y677F probably damaging Het
Spinkl A G 18: 44,168,146 Y42H probably damaging Het
Srsf6 T C 2: 162,932,862 F102L probably benign Het
Sstr3 T C 15: 78,540,517 E10G probably benign Het
Tekt3 A T 11: 63,094,660 I431F probably damaging Het
Trio C T 15: 27,854,939 R778H possibly damaging Het
Ush2a T A 1: 188,549,913 V1875D probably damaging Het
Vmn2r29 A C 7: 7,231,442 I815S probably damaging Het
Vmn2r78 A T 7: 86,954,344 K577* probably null Het
Yes1 G A 5: 32,645,086 R115Q probably benign Het
Other mutations in Alg9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01634:Alg9 APN 9 50775377 splice site probably null
IGL02792:Alg9 APN 9 50842748 missense possibly damaging 0.90
gum_drop UTSW 9 50805354 missense possibly damaging 0.90
FR4976:Alg9 UTSW 9 50775431 unclassified probably benign
R1183:Alg9 UTSW 9 50789533 missense possibly damaging 0.82
R1270:Alg9 UTSW 9 50787572 intron probably benign
R1575:Alg9 UTSW 9 50775502 missense possibly damaging 0.65
R1773:Alg9 UTSW 9 50779096 missense probably benign 0.30
R1837:Alg9 UTSW 9 50806315 missense probably damaging 1.00
R2011:Alg9 UTSW 9 50788200 missense probably damaging 1.00
R4324:Alg9 UTSW 9 50805343 missense probably damaging 1.00
R4514:Alg9 UTSW 9 50805354 missense possibly damaging 0.90
R4544:Alg9 UTSW 9 50805354 missense possibly damaging 0.90
R4546:Alg9 UTSW 9 50805354 missense possibly damaging 0.90
R4996:Alg9 UTSW 9 50808705 missense probably damaging 1.00
R5007:Alg9 UTSW 9 50788224 missense probably damaging 1.00
R5053:Alg9 UTSW 9 50788172 missense probably damaging 1.00
R5308:Alg9 UTSW 9 50822711 missense possibly damaging 0.95
R6803:Alg9 UTSW 9 50789560 missense probably benign 0.37
R6994:Alg9 UTSW 9 50792122 nonsense probably null
R6998:Alg9 UTSW 9 50789621 missense possibly damaging 0.95
R7298:Alg9 UTSW 9 50779061 missense probably damaging 0.97
R7480:Alg9 UTSW 9 50822628 missense probably benign 0.06
R7561:Alg9 UTSW 9 50842774 missense possibly damaging 0.95
R7721:Alg9 UTSW 9 50776642 missense probably damaging 0.99
R7829:Alg9 UTSW 9 50788171 missense probably damaging 1.00
R7847:Alg9 UTSW 9 50789605 missense possibly damaging 0.62
R7878:Alg9 UTSW 9 50842783 missense probably benign 0.00
R8113:Alg9 UTSW 9 50808780 nonsense probably null
R8257:Alg9 UTSW 9 50779087 missense possibly damaging 0.62
RF003:Alg9 UTSW 9 50775427 unclassified probably benign
RF006:Alg9 UTSW 9 50775417 unclassified probably benign
RF058:Alg9 UTSW 9 50775427 unclassified probably benign
Z1177:Alg9 UTSW 9 50788173 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAGTGCGACTTGCTTTCTG -3'
(R):5'- TTTCCAGATGCTGCCATGGC -3'

Sequencing Primer
(F):5'- CAGTGCGACTTGCTTTCTGAAAAG -3'
(R):5'- GCAATCTGCATACAACATTAGGACTG -3'
Posted On2019-10-24