Incidental Mutation 'R0621:C130073F10Rik'
ID 58660
Institutional Source Beutler Lab
Gene Symbol C130073F10Rik
Ensembl Gene ENSMUSG00000046133
Gene Name RIKEN cDNA C130073F10 gene
Synonyms
MMRRC Submission 038810-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.064) question?
Stock # R0621 (G1)
Quality Score 225
Status Not validated
Chromosome 4
Chromosomal Location 101747217-101750986 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 101747992 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Histidine at position 61 (Y61H)
Ref Sequence ENSEMBL: ENSMUSP00000059092 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051043]
AlphaFold Q8C4L8
Predicted Effect probably damaging
Transcript: ENSMUST00000051043
AA Change: Y61H

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 99.0%
  • 10x: 97.8%
  • 20x: 96.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abr T C 11: 76,399,898 (GRCm39) D33G probably damaging Het
Adgre1 T A 17: 57,748,359 (GRCm39) S520T probably damaging Het
Afg2a C T 3: 37,486,178 (GRCm39) T300I probably benign Het
Ankrd40 A G 11: 94,230,433 (GRCm39) probably null Het
Aph1b A T 9: 66,686,616 (GRCm39) I177K possibly damaging Het
Armc3 A T 2: 19,300,204 (GRCm39) N579I probably damaging Het
Atxn7l1 T C 12: 33,376,099 (GRCm39) V131A probably benign Het
C1s2 A T 6: 124,608,071 (GRCm39) L214Q probably damaging Het
Caprin2 A T 6: 148,760,176 (GRCm39) S425T possibly damaging Het
Cdc42ep4 G A 11: 113,619,522 (GRCm39) R290C probably damaging Het
Cenpf T C 1: 189,404,825 (GRCm39) T352A probably benign Het
Col6a4 A T 9: 105,943,990 (GRCm39) F1161L probably damaging Het
Dctn2 T C 10: 127,113,809 (GRCm39) probably null Het
Ddx24 T C 12: 103,391,817 (GRCm39) probably benign Het
Dsg1c C A 18: 20,412,752 (GRCm39) A591D possibly damaging Het
Efnb3 T C 11: 69,446,798 (GRCm39) D304G probably damaging Het
Erbb3 T C 10: 128,422,094 (GRCm39) Y50C probably benign Het
Eya3 T G 4: 132,422,113 (GRCm39) D275E probably benign Het
Fam81a G T 9: 70,000,929 (GRCm39) Q272K probably benign Het
Foxf1 T C 8: 121,811,919 (GRCm39) V261A probably damaging Het
Gm9637 G A 14: 19,402,011 (GRCm38) noncoding transcript Het
Gnb4 C T 3: 32,645,356 (GRCm39) V112I probably benign Het
Gtf2h2 A T 13: 100,625,433 (GRCm39) L61Q probably damaging Het
Hey2 T A 10: 30,710,382 (GRCm39) I124F probably benign Het
Hoxb3 A T 11: 96,236,789 (GRCm39) Y289F probably damaging Het
Kctd3 C T 1: 188,713,538 (GRCm39) R399Q probably damaging Het
Kif26b C G 1: 178,743,218 (GRCm39) P1105A probably benign Het
Klhl30 C T 1: 91,285,585 (GRCm39) T369M probably damaging Het
Lipo2 C T 19: 33,708,339 (GRCm39) G225D probably damaging Het
Macf1 T C 4: 123,274,327 (GRCm39) K6350E probably damaging Het
Myh13 A C 11: 67,232,058 (GRCm39) N446T probably damaging Het
Nos1ap T C 1: 170,146,150 (GRCm39) D468G probably damaging Het
Or10j2 C T 1: 173,098,242 (GRCm39) P167S possibly damaging Het
Or11h7 G A 14: 50,891,419 (GRCm39) G242R possibly damaging Het
Or4a77 C A 2: 89,487,459 (GRCm39) E109* probably null Het
Pde3a T C 6: 141,195,725 (GRCm39) L137P probably damaging Het
Ppm1f G A 16: 16,733,172 (GRCm39) R233Q probably benign Het
Rtf2 C A 2: 172,308,216 (GRCm39) A205E possibly damaging Het
Sh2d5 T C 4: 137,985,629 (GRCm39) F359S probably benign Het
Siglec1 G A 2: 130,916,188 (GRCm39) T1254M probably benign Het
Slc39a11 G A 11: 113,354,905 (GRCm39) P108L probably benign Het
Slc6a5 G A 7: 49,567,113 (GRCm39) probably null Het
Snph C T 2: 151,435,642 (GRCm39) V360M probably damaging Het
Snx29 A G 16: 11,223,651 (GRCm39) probably null Het
Sos1 A G 17: 80,759,408 (GRCm39) probably null Het
St8sia6 T A 2: 13,662,093 (GRCm39) N246I probably damaging Het
Thy1 T A 9: 43,958,030 (GRCm39) F53I probably damaging Het
Tle3 T A 9: 61,317,387 (GRCm39) Y421* probably null Het
Ttc21b C T 2: 66,056,355 (GRCm39) R677Q probably benign Het
Vmn2r107 A T 17: 20,595,252 (GRCm39) I602F probably benign Het
Wdr17 C A 8: 55,096,226 (GRCm39) G1016C probably benign Het
Wdr62 T C 7: 29,953,486 (GRCm39) E182G possibly damaging Het
Zfp597 A G 16: 3,684,228 (GRCm39) I176T probably benign Het
Other mutations in C130073F10Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02805:C130073F10Rik APN 4 101,748,171 (GRCm39) start codon destroyed probably null 1.00
IGL02869:C130073F10Rik APN 4 101,747,590 (GRCm39) nonsense probably null
R1368:C130073F10Rik UTSW 4 101,747,953 (GRCm39) missense possibly damaging 0.78
R1471:C130073F10Rik UTSW 4 101,747,535 (GRCm39) missense probably benign 0.01
R4732:C130073F10Rik UTSW 4 101,747,907 (GRCm39) missense probably benign 0.03
R4733:C130073F10Rik UTSW 4 101,747,907 (GRCm39) missense probably benign 0.03
R5372:C130073F10Rik UTSW 4 101,747,684 (GRCm39) missense probably damaging 1.00
R5777:C130073F10Rik UTSW 4 101,747,946 (GRCm39) missense possibly damaging 0.49
R6510:C130073F10Rik UTSW 4 101,747,482 (GRCm39) missense probably benign 0.01
R6888:C130073F10Rik UTSW 4 101,747,453 (GRCm39) missense probably benign 0.12
R7229:C130073F10Rik UTSW 4 101,747,439 (GRCm39) missense probably benign 0.00
R8186:C130073F10Rik UTSW 4 101,748,031 (GRCm39) nonsense probably null
R8353:C130073F10Rik UTSW 4 101,747,881 (GRCm39) splice site probably null
R8857:C130073F10Rik UTSW 4 101,747,555 (GRCm39) missense possibly damaging 0.52
R9559:C130073F10Rik UTSW 4 101,747,946 (GRCm39) missense possibly damaging 0.49
R9590:C130073F10Rik UTSW 4 101,747,618 (GRCm39) missense probably benign 0.41
Predicted Primers PCR Primer
(F):5'- GGTTGGCATCCAGCAAATAGACCTC -3'
(R):5'- TCCAGCACCTGACGATCCAGTTTC -3'

Sequencing Primer
(F):5'- GCAAATAGACCTCTTTCAGTCTAC -3'
(R):5'- CTGCTGAATCATGAAGACTTGG -3'
Posted On 2013-07-11