Incidental Mutation 'R7578:Slc39a2'
ID586602
Institutional Source Beutler Lab
Gene Symbol Slc39a2
Ensembl Gene ENSMUSG00000072572
Gene Namesolute carrier family 39 (zinc transporter), member 2
Synonymszip2, F730005G13Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.056) question?
Stock #R7578 (G1)
Quality Score225.009
Status Validated
Chromosome14
Chromosomal Location51892889-51896745 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 51895416 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 272 (V272A)
Ref Sequence ENSEMBL: ENSMUSP00000038707 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047726] [ENSMUST00000047899] [ENSMUST00000164252] [ENSMUST00000164902] [ENSMUST00000165100] [ENSMUST00000165568]
Predicted Effect probably damaging
Transcript: ENSMUST00000047726
AA Change: V272A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000038707
Gene: ENSMUSG00000072572
AA Change: V272A

DomainStartEndE-ValueType
Pfam:Zip 5 306 1.1e-59 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000047899
SMART Domains Protein: ENSMUSP00000047720
Gene: ENSMUSG00000004561

DomainStartEndE-ValueType
low complexity region 8 21 N/A INTRINSIC
low complexity region 63 76 N/A INTRINSIC
Pfam:Rsm22 153 442 8e-65 PFAM
Pfam:Methyltransf_11 191 293 5.9e-7 PFAM
low complexity region 446 460 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000164252
SMART Domains Protein: ENSMUSP00000130038
Gene: ENSMUSG00000004561

DomainStartEndE-ValueType
low complexity region 8 21 N/A INTRINSIC
low complexity region 63 76 N/A INTRINSIC
Pfam:Rsm22 153 235 2.1e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000164902
SMART Domains Protein: ENSMUSP00000130200
Gene: ENSMUSG00000004561

DomainStartEndE-ValueType
low complexity region 8 21 N/A INTRINSIC
low complexity region 63 76 N/A INTRINSIC
Pfam:Rsm22 153 467 1.7e-61 PFAM
Pfam:Methyltransf_11 191 294 3.6e-6 PFAM
low complexity region 471 485 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000165100
SMART Domains Protein: ENSMUSP00000132354
Gene: ENSMUSG00000004561

DomainStartEndE-ValueType
low complexity region 8 21 N/A INTRINSIC
low complexity region 63 76 N/A INTRINSIC
Pfam:Rsm22 153 235 2.1e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000165568
SMART Domains Protein: ENSMUSP00000129973
Gene: ENSMUSG00000004561

DomainStartEndE-ValueType
Pfam:Rsm22 100 269 1.5e-37 PFAM
Pfam:Methyltransf_11 138 240 2.1e-7 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 97% (66/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the ZIP family of metal ion transporters. The encoded protein functions as a zinc transporter. Mutations in this gene may be associated with susceptibility to carotid artery disease. Multiple transcript variants have been described. [provided by RefSeq, Mar 2010]
PHENOTYPE: Homozygotes for a null allele are overtly normal when fed a zinc-replete diet but show increased sensitivity to the effects of maternal dietary zinc deficiency during pregnancy. Resulting embryos are often growth retarded with craniofacial and limb defects, and show altered iron and calcium levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001J03Rik A T 5: 146,183,533 V165E probably damaging Het
1700025G04Rik T G 1: 151,921,090 T75P probably benign Het
4930516K23Rik T C 7: 104,058,897 E235G probably benign Het
Adam15 A G 3: 89,344,192 C449R probably damaging Het
Adam24 T C 8: 40,680,255 V254A probably benign Het
Akap9 C G 5: 3,968,745 H1109D probably benign Het
Aldh1a1 A C 19: 20,618,002 R98S probably damaging Het
Alg9 A G 9: 50,789,535 I202V probably benign Het
Anks1b G A 10: 90,049,927 E162K probably damaging Het
Armc4 A T 18: 7,211,593 D760E probably benign Het
Atp6v1b2 A G 8: 69,103,476 T268A probably benign Het
Atxn1 C T 13: 45,567,358 V354I probably benign Het
B3galt1 A G 2: 68,118,552 T204A probably damaging Het
Catsperb T A 12: 101,588,285 I746K probably benign Het
Cdh23 G A 10: 60,407,407 T1063M probably benign Het
Cherp G A 8: 72,464,258 R543C Het
Cldn20 A G 17: 3,532,999 D149G probably damaging Het
Clk2 A G 3: 89,176,500 Q474R probably benign Het
Cp A G 3: 19,989,098 T1017A possibly damaging Het
Cyp2c39 T C 19: 39,510,956 L29P probably damaging Het
Dscr3 A C 16: 94,499,069 N275K probably damaging Het
Ebf3 C T 7: 137,313,532 V93M probably damaging Het
Eef1akmt1 T A 14: 57,549,871 M183L probably damaging Het
Fam160a1 G T 3: 85,665,898 L915I probably damaging Het
Fam71d T C 12: 78,715,501 probably null Het
Filip1l A G 16: 57,513,282 E146G probably damaging Het
Fpr-rs3 T C 17: 20,624,031 S283G possibly damaging Het
Fras1 A T 5: 96,684,437 Y1543F probably damaging Het
Gbp10 G A 5: 105,236,149 probably benign Het
Gjd3 A G 11: 98,982,475 V181A probably damaging Het
Gm49368 T A 7: 128,112,258 C711* probably null Het
Gtf3c2 A G 5: 31,172,997 S210P probably benign Het
Herc2 A G 7: 56,134,800 Y1404C probably benign Het
Il22ra2 T A 10: 19,631,624 D128E probably benign Het
Itgav T A 2: 83,747,875 D113E probably benign Het
Kcnd3 A G 3: 105,459,617 M268V probably benign Het
Kirrel3 G T 9: 34,939,112 G19V probably damaging Het
Klf17 T G 4: 117,760,719 Y147S possibly damaging Het
Leng1 C T 7: 3,665,383 R22H probably damaging Het
Lysmd4 T A 7: 67,226,289 Y233* probably null Het
Lyzl6 A G 11: 103,635,006 V96A probably benign Het
Mki67 T C 7: 135,700,915 T797A possibly damaging Het
Nuf2 G T 1: 169,504,528 H399Q probably benign Het
Nuggc T C 14: 65,648,174 V766A probably damaging Het
Oas1c A T 5: 120,802,179 D307E probably damaging Het
Olfr432 T A 1: 174,050,700 M109K possibly damaging Het
Olfr785 T C 10: 129,409,675 I103T probably damaging Het
P4ha3 T C 7: 100,293,914 Y169H probably benign Het
Perm1 TGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCT TGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCT 4: 156,218,068 probably benign Het
Pkhd1 T C 1: 20,347,361 D2522G probably damaging Het
Prickle2 T C 6: 92,411,290 D433G probably benign Het
Ptcd3 A G 6: 71,908,707 S12P probably benign Het
Ptpn23 T A 9: 110,387,608 Q1060L probably benign Het
Rai14 G T 15: 10,574,828 N710K probably benign Het
Rai14 C T 15: 10,593,103 G152R probably damaging Het
Rsf1 CGGC CGGCGGCGGGGGC 7: 97,579,932 probably benign Het
Satb2 A G 1: 56,871,784 V234A probably benign Het
Scg2 T C 1: 79,436,895 Q37R probably damaging Het
Slc35e3 A T 10: 117,740,579 S230T probably damaging Het
Smg7 T A 1: 152,845,430 Y677F probably damaging Het
Spinkl A G 18: 44,168,146 Y42H probably damaging Het
Srsf6 T C 2: 162,932,862 F102L probably benign Het
Sstr3 T C 15: 78,540,517 E10G probably benign Het
Tekt3 A T 11: 63,094,660 I431F probably damaging Het
Trio C T 15: 27,854,939 R778H possibly damaging Het
Ush2a T A 1: 188,549,913 V1875D probably damaging Het
Vmn2r29 A C 7: 7,231,442 I815S probably damaging Het
Vmn2r78 A T 7: 86,954,344 K577* probably null Het
Yes1 G A 5: 32,645,086 R115Q probably benign Het
Other mutations in Slc39a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01315:Slc39a2 APN 14 51895136 nonsense probably null
IGL02421:Slc39a2 APN 14 51893872 missense probably benign 0.00
IGL02546:Slc39a2 APN 14 51895163 missense probably benign 0.16
IGL02823:Slc39a2 APN 14 51895412 missense probably damaging 1.00
R1126:Slc39a2 UTSW 14 51894145 missense probably damaging 1.00
R4923:Slc39a2 UTSW 14 51895254 missense probably damaging 1.00
R5106:Slc39a2 UTSW 14 51895531 makesense probably null
R6158:Slc39a2 UTSW 14 51894224 unclassified probably null
R7094:Slc39a2 UTSW 14 51893689 unclassified probably benign
R7324:Slc39a2 UTSW 14 51894193 missense possibly damaging 0.74
R7340:Slc39a2 UTSW 14 51894203 missense possibly damaging 0.87
R7599:Slc39a2 UTSW 14 51895031 missense probably benign 0.10
Z1177:Slc39a2 UTSW 14 51893895 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCGCTGTGCTGGCTCATAAG -3'
(R):5'- CCGAAGTTATTGAGGGAGTGTCC -3'

Sequencing Primer
(F):5'- CCTGAGGCTGGGGAAGATC -3'
(R):5'- CCTTAGAAGTAGTTATCCTAGGTAGG -3'
Posted On2019-10-24