Incidental Mutation 'R7579:Slco1a5'
ID586636
Institutional Source Beutler Lab
Gene Symbol Slco1a5
Ensembl Gene ENSMUSG00000063975
Gene Namesolute carrier organic anion transporter family, member 1a5
SynonymsOatp3, Slc21a7
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.067) question?
Stock #R7579 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location142234227-142322981 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 142275481 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 13 (V13A)
Ref Sequence ENSEMBL: ENSMUSP00000080116 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081380] [ENSMUST00000111825] [ENSMUST00000128446] [ENSMUST00000153268]
Predicted Effect probably benign
Transcript: ENSMUST00000081380
AA Change: V13A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000080116
Gene: ENSMUSG00000063975
AA Change: V13A

DomainStartEndE-ValueType
Pfam:MFS_1 22 420 4.3e-30 PFAM
KAZAL 438 486 2.18e0 SMART
transmembrane domain 600 622 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111825
AA Change: V13A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000137607
Gene: ENSMUSG00000063975
AA Change: V13A

DomainStartEndE-ValueType
Pfam:MFS_1 22 420 5.8e-30 PFAM
KAZAL 438 486 2.18e0 SMART
transmembrane domain 600 622 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000128446
SMART Domains Protein: ENSMUSP00000124987
Gene: ENSMUSG00000063975

DomainStartEndE-ValueType
Pfam:OATP 1 157 6.1e-67 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000153268
AA Change: V13A

PolyPhen 2 Score 0.039 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000124829
Gene: ENSMUSG00000063975
AA Change: V13A

DomainStartEndE-ValueType
Pfam:OATP 19 74 3.4e-16 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 96% (51/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a sodium-independent transporter which mediates cellular uptake of organic ions in the liver. Its substrates include bile acids, bromosulphophthalein, and some steroidal compounds. The protein is a member of the SLC21A family of solute carriers. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Dec 2008]
PHENOTYPE: Homozygous mutation of this gene results in decreased percentage of CD8 ells and increased percentage of B cells in the peripheral blood. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsm4 G T 7: 119,693,710 R21L probably benign Het
Adgb T A 10: 10,410,818 R120* probably null Het
Adgra3 C A 5: 49,987,635 A539S probably benign Het
Ank2 A G 3: 126,946,398 S1946P unknown Het
Card6 TTGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGCGGATGAGAGGGCTTAGCATGGGAGGACTG TTGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGCGGATGAGAGGGCTTAGCATGGGAGGACTG 15: 5,098,691 probably benign Het
Cdc20b A T 13: 113,037,048 probably null Het
Cfh T G 1: 140,108,590 D730A possibly damaging Het
Dennd1a T C 2: 37,858,432 H345R probably damaging Het
Dhx36 T C 3: 62,480,873 S614G possibly damaging Het
Dio1 C T 4: 107,292,386 V240I possibly damaging Het
Dnah12 A G 14: 26,770,503 D1200G probably benign Het
Dpy19l4 A T 4: 11,265,909 S680T probably benign Het
Eef2 CCC CCCC 10: 81,178,768 probably null Het
Fcrlb T C 1: 170,907,847 probably null Het
Gad1 T A 2: 70,587,132 I253K possibly damaging Het
Gars A G 6: 55,077,703 D665G probably damaging Het
Gldn A G 9: 54,338,364 T400A probably benign Het
Gm1110 C A 9: 26,883,826 V455L possibly damaging Het
Gm11444 A G 11: 85,850,243 V30A unknown Het
Gm5134 T C 10: 75,964,437 S51P probably damaging Het
Gprc6a C T 10: 51,626,787 A327T probably benign Het
Gstt2 A T 10: 75,834,185 D34E probably benign Het
Icam2 A G 11: 106,380,763 F78L probably damaging Het
Jakmip1 T G 5: 37,127,458 C630G possibly damaging Het
Kcnu1 A T 8: 25,896,658 N523I probably damaging Het
Klf10 A G 15: 38,297,038 S253P probably benign Het
Mmd2 A T 5: 142,608,606 M1K probably null Het
Mroh2b G T 15: 4,931,061 G759C probably benign Het
Olfr1079 C T 2: 86,538,528 C127Y probably damaging Het
Olfr1493-ps1 T C 19: 13,727,101 L280P probably damaging Het
Olfr1535 A T 13: 21,556,006 N5K probably benign Het
Orc5 A G 5: 22,550,199 F22S possibly damaging Het
Prlr A G 15: 10,328,935 I499V probably benign Het
Ptbp1 A G 10: 79,859,120 N94S probably benign Het
Rassf3 C A 10: 121,476,198 probably benign Het
Rbm33 C T 5: 28,368,266 P455S probably damaging Het
Sgcd C G 11: 47,125,654 G127A possibly damaging Het
Slc22a13 A G 9: 119,195,160 I336T possibly damaging Het
Slc25a31 A T 3: 40,725,040 D312V possibly damaging Het
Slc37a4 G A 9: 44,401,521 S324N probably benign Het
Srgap2 T C 1: 131,292,633 H907R probably damaging Het
Supv3l1 A C 10: 62,435,708 V381G probably damaging Het
Supv3l1 C A 10: 62,435,709 V381L possibly damaging Het
Syne1 T C 10: 5,349,324 D977G probably damaging Het
Syt3 T A 7: 44,390,848 Y168* probably null Het
Tshz1 A T 18: 84,014,665 Y539* probably null Het
Ttll13 A G 7: 80,258,233 K501R probably benign Het
Ttn G A 2: 76,782,388 Q17116* probably null Het
Vcan T C 13: 89,692,458 T1656A probably damaging Het
Vmn1r73 G T 7: 11,757,155 C300F probably benign Het
Vmn2r9 T C 5: 108,845,082 K521E probably damaging Het
Zdhhc11 T A 13: 73,982,766 probably benign Het
Zfp760 T C 17: 21,722,926 S361P possibly damaging Het
Zranb2 A G 3: 157,540,672 Y114C probably damaging Het
Other mutations in Slco1a5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01304:Slco1a5 APN 6 142242150 missense probably benign 0.00
IGL01432:Slco1a5 APN 6 142236286 missense possibly damaging 0.59
IGL01590:Slco1a5 APN 6 142250319 missense probably benign 0.01
IGL01824:Slco1a5 APN 6 142253037 missense probably benign 0.01
IGL01915:Slco1a5 APN 6 142243873 missense probably benign 0.00
IGL01945:Slco1a5 APN 6 142243989 critical splice acceptor site probably null
IGL02078:Slco1a5 APN 6 142254446 missense probably benign 0.30
IGL02178:Slco1a5 APN 6 142262688 nonsense probably null
IGL02366:Slco1a5 APN 6 142250215 missense possibly damaging 0.57
IGL02395:Slco1a5 APN 6 142275487 missense probably damaging 0.99
IGL02621:Slco1a5 APN 6 142242015 missense probably benign 0.10
IGL02752:Slco1a5 APN 6 142262712 missense probably benign 0.07
IGL02940:Slco1a5 APN 6 142242005 missense probably damaging 1.00
IGL03065:Slco1a5 APN 6 142248843 splice site probably benign
IGL03377:Slco1a5 APN 6 142234766 missense probably benign 0.01
R0017:Slco1a5 UTSW 6 142236335 splice site probably benign
R0017:Slco1a5 UTSW 6 142236335 splice site probably benign
R0230:Slco1a5 UTSW 6 142236328 splice site probably benign
R0690:Slco1a5 UTSW 6 142268278 missense probably benign 0.24
R1217:Slco1a5 UTSW 6 142254374 missense probably damaging 0.98
R1900:Slco1a5 UTSW 6 142242063 missense probably benign 0.44
R2084:Slco1a5 UTSW 6 142234711 missense probably benign 0.32
R2393:Slco1a5 UTSW 6 142248775 missense possibly damaging 0.85
R2414:Slco1a5 UTSW 6 142236250 missense probably damaging 1.00
R2760:Slco1a5 UTSW 6 142250271 missense probably benign 0.00
R3420:Slco1a5 UTSW 6 142268238 missense possibly damaging 0.61
R3421:Slco1a5 UTSW 6 142268238 missense possibly damaging 0.61
R3827:Slco1a5 UTSW 6 142253249 missense probably damaging 0.97
R3963:Slco1a5 UTSW 6 142248644 critical splice donor site probably null
R3977:Slco1a5 UTSW 6 142258972 splice site probably benign
R4074:Slco1a5 UTSW 6 142268224 missense possibly damaging 0.88
R4075:Slco1a5 UTSW 6 142268224 missense possibly damaging 0.88
R4076:Slco1a5 UTSW 6 142268224 missense possibly damaging 0.88
R4782:Slco1a5 UTSW 6 142248807 missense possibly damaging 0.82
R4799:Slco1a5 UTSW 6 142248807 missense possibly damaging 0.82
R4831:Slco1a5 UTSW 6 142234705 missense probably benign
R5038:Slco1a5 UTSW 6 142262637 missense probably benign 0.01
R5038:Slco1a5 UTSW 6 142266364 missense probably damaging 1.00
R5063:Slco1a5 UTSW 6 142259065 missense probably damaging 1.00
R5273:Slco1a5 UTSW 6 142242098 missense probably benign 0.00
R5436:Slco1a5 UTSW 6 142254392 missense probably damaging 1.00
R5579:Slco1a5 UTSW 6 142242125 missense possibly damaging 0.93
R5602:Slco1a5 UTSW 6 142275529 start gained probably benign
R5643:Slco1a5 UTSW 6 142237594 splice site probably null
R5644:Slco1a5 UTSW 6 142237594 splice site probably null
R5686:Slco1a5 UTSW 6 142236307 missense probably damaging 1.00
R5699:Slco1a5 UTSW 6 142248816 missense probably damaging 0.96
R5792:Slco1a5 UTSW 6 142242113 missense probably damaging 1.00
R5938:Slco1a5 UTSW 6 142248717 missense probably damaging 0.97
R5997:Slco1a5 UTSW 6 142253113 missense probably benign 0.19
R6146:Slco1a5 UTSW 6 142234808 missense probably benign
R6377:Slco1a5 UTSW 6 142242180 splice site probably null
R6466:Slco1a5 UTSW 6 142237534 missense probably benign 0.01
R6523:Slco1a5 UTSW 6 142266395 missense probably damaging 1.00
R7092:Slco1a5 UTSW 6 142248675 missense probably benign
R7207:Slco1a5 UTSW 6 142248749 nonsense probably null
R7356:Slco1a5 UTSW 6 142234732 missense probably benign 0.01
R7430:Slco1a5 UTSW 6 142248712 missense probably benign 0.00
R7445:Slco1a5 UTSW 6 142259008 missense possibly damaging 0.93
R7499:Slco1a5 UTSW 6 142262531 intron probably null
Predicted Primers PCR Primer
(F):5'- TCTTGGCTGAATAATCCTGGAAAGAC -3'
(R):5'- CCTAGCCCTAAGAGAACACTTG -3'

Sequencing Primer
(F):5'- AAGGCAAGGCTTTCATG -3'
(R):5'- GCCCTAAGAGAACACTTGCTGTTTG -3'
Posted On2019-10-24