Incidental Mutation 'R7579:Gm1110'
ID586642
Institutional Source Beutler Lab
Gene Symbol Gm1110
Ensembl Gene ENSMUSG00000079644
Gene Namepredicted gene 1110
SynonymsLOC382064
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.076) question?
Stock #R7579 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location26879567-26923111 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 26883826 bp
ZygosityHeterozygous
Amino Acid Change Valine to Leucine at position 455 (V455L)
Ref Sequence ENSEMBL: ENSMUSP00000110916 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000115261]
Predicted Effect possibly damaging
Transcript: ENSMUST00000115261
AA Change: V455L

PolyPhen 2 Score 0.934 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000110916
Gene: ENSMUSG00000079644
AA Change: V455L

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:Glyco_hydro_35 55 368 2e-93 PFAM
Pfam:Glyco_hydro_42 70 229 1e-12 PFAM
Meta Mutation Damage Score 0.1106 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 96% (51/53)
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsm4 G T 7: 119,693,710 R21L probably benign Het
Adgb T A 10: 10,410,818 R120* probably null Het
Adgra3 C A 5: 49,987,635 A539S probably benign Het
Ank2 A G 3: 126,946,398 S1946P unknown Het
Card6 TTGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGCGGATGAGAGGGCTTAGCATGGGAGGACTG TTGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGCGGATGAGAGGGCTTAGCATGGGAGGACTG 15: 5,098,691 probably benign Het
Cdc20b A T 13: 113,037,048 probably null Het
Cfh T G 1: 140,108,590 D730A possibly damaging Het
Dennd1a T C 2: 37,858,432 H345R probably damaging Het
Dhx36 T C 3: 62,480,873 S614G possibly damaging Het
Dio1 C T 4: 107,292,386 V240I possibly damaging Het
Dnah12 A G 14: 26,770,503 D1200G probably benign Het
Dpy19l4 A T 4: 11,265,909 S680T probably benign Het
Eef2 CCC CCCC 10: 81,178,768 probably null Het
Fcrlb T C 1: 170,907,847 probably null Het
Gad1 T A 2: 70,587,132 I253K possibly damaging Het
Gars A G 6: 55,077,703 D665G probably damaging Het
Gldn A G 9: 54,338,364 T400A probably benign Het
Gm11444 A G 11: 85,850,243 V30A unknown Het
Gm5134 T C 10: 75,964,437 S51P probably damaging Het
Gprc6a C T 10: 51,626,787 A327T probably benign Het
Gstt2 A T 10: 75,834,185 D34E probably benign Het
Icam2 A G 11: 106,380,763 F78L probably damaging Het
Jakmip1 T G 5: 37,127,458 C630G possibly damaging Het
Kcnu1 A T 8: 25,896,658 N523I probably damaging Het
Klf10 A G 15: 38,297,038 S253P probably benign Het
Mmd2 A T 5: 142,608,606 M1K probably null Het
Mroh2b G T 15: 4,931,061 G759C probably benign Het
Olfr1079 C T 2: 86,538,528 C127Y probably damaging Het
Olfr1493-ps1 T C 19: 13,727,101 L280P probably damaging Het
Olfr1535 A T 13: 21,556,006 N5K probably benign Het
Orc5 A G 5: 22,550,199 F22S possibly damaging Het
Prlr A G 15: 10,328,935 I499V probably benign Het
Ptbp1 A G 10: 79,859,120 N94S probably benign Het
Rassf3 C A 10: 121,476,198 probably benign Het
Rbm33 C T 5: 28,368,266 P455S probably damaging Het
Sgcd C G 11: 47,125,654 G127A possibly damaging Het
Slc22a13 A G 9: 119,195,160 I336T possibly damaging Het
Slc25a31 A T 3: 40,725,040 D312V possibly damaging Het
Slc37a4 G A 9: 44,401,521 S324N probably benign Het
Slco1a5 A G 6: 142,275,481 V13A probably benign Het
Srgap2 T C 1: 131,292,633 H907R probably damaging Het
Supv3l1 C A 10: 62,435,709 V381L possibly damaging Het
Supv3l1 A C 10: 62,435,708 V381G probably damaging Het
Syne1 T C 10: 5,349,324 D977G probably damaging Het
Syt3 T A 7: 44,390,848 Y168* probably null Het
Tshz1 A T 18: 84,014,665 Y539* probably null Het
Ttll13 A G 7: 80,258,233 K501R probably benign Het
Ttn G A 2: 76,782,388 Q17116* probably null Het
Vcan T C 13: 89,692,458 T1656A probably damaging Het
Vmn1r73 G T 7: 11,757,155 C300F probably benign Het
Vmn2r9 T C 5: 108,845,082 K521E probably damaging Het
Zdhhc11 T A 13: 73,982,766 probably benign Het
Zfp760 T C 17: 21,722,926 S361P possibly damaging Het
Zranb2 A G 3: 157,540,672 Y114C probably damaging Het
Other mutations in Gm1110
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00591:Gm1110 APN 9 26880874 nonsense probably null
IGL01089:Gm1110 APN 9 26881860 missense probably benign
IGL01631:Gm1110 APN 9 26897916 critical splice donor site probably null
IGL02008:Gm1110 APN 9 26883230 missense probably benign 0.09
IGL02331:Gm1110 APN 9 26913287 critical splice donor site probably null
IGL02335:Gm1110 APN 9 26881763 missense probably benign 0.00
IGL02550:Gm1110 APN 9 26881834 missense probably benign 0.09
IGL02614:Gm1110 APN 9 26920714 missense probably benign 0.11
IGL03409:Gm1110 APN 9 26896620 missense probably benign 0.21
PIT4458001:Gm1110 UTSW 9 26880828 missense probably benign 0.00
R0189:Gm1110 UTSW 9 26883218 missense probably null 0.99
R0271:Gm1110 UTSW 9 26920666 missense probably damaging 1.00
R1034:Gm1110 UTSW 9 26921350 missense probably damaging 1.00
R1229:Gm1110 UTSW 9 26881806 missense probably benign
R1355:Gm1110 UTSW 9 26883761 missense probably benign 0.01
R1566:Gm1110 UTSW 9 26880870 missense probably damaging 1.00
R1574:Gm1110 UTSW 9 26881126 splice site probably benign
R1916:Gm1110 UTSW 9 26889638 missense probably damaging 1.00
R2011:Gm1110 UTSW 9 26894258 missense probably benign 0.01
R2214:Gm1110 UTSW 9 26902490 missense probably benign 0.37
R2567:Gm1110 UTSW 9 26920696 missense probably benign
R2967:Gm1110 UTSW 9 26881043 missense probably benign 0.05
R4271:Gm1110 UTSW 9 26895648 critical splice donor site probably null
R4683:Gm1110 UTSW 9 26920594 missense probably damaging 0.99
R4945:Gm1110 UTSW 9 26920595 missense possibly damaging 0.46
R5015:Gm1110 UTSW 9 26881866 missense probably benign 0.01
R5089:Gm1110 UTSW 9 26882387 missense probably damaging 0.96
R5225:Gm1110 UTSW 9 26902478 missense probably damaging 1.00
R5239:Gm1110 UTSW 9 26893570 missense probably benign 0.00
R5395:Gm1110 UTSW 9 26889632 missense probably benign
R5783:Gm1110 UTSW 9 26882336 missense probably benign
R6045:Gm1110 UTSW 9 26883209 critical splice donor site probably null
R6245:Gm1110 UTSW 9 26920747 missense probably benign 0.04
R6357:Gm1110 UTSW 9 26914128 splice site probably null
R6863:Gm1110 UTSW 9 26881064 missense probably damaging 1.00
R7336:Gm1110 UTSW 9 26914357 missense probably damaging 0.99
R7454:Gm1110 UTSW 9 26920649 missense probably benign
R7555:Gm1110 UTSW 9 26893628 missense probably benign 0.05
R7990:Gm1110 UTSW 9 26880841 missense possibly damaging 0.66
R8062:Gm1110 UTSW 9 26881821 missense probably damaging 0.99
R8108:Gm1110 UTSW 9 26920661 missense probably damaging 1.00
R8323:Gm1110 UTSW 9 26902423 critical splice donor site probably null
R8354:Gm1110 UTSW 9 26883280 missense probably benign 0.01
R8354:Gm1110 UTSW 9 26883281 missense probably benign 0.00
R8454:Gm1110 UTSW 9 26883280 missense probably benign 0.01
R8454:Gm1110 UTSW 9 26883281 missense probably benign 0.00
RF002:Gm1110 UTSW 9 26920640 missense probably damaging 1.00
X0063:Gm1110 UTSW 9 26894280 missense probably benign 0.01
Z1088:Gm1110 UTSW 9 26913310 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- ATAACCCTCCCTGCGATTGC -3'
(R):5'- GAATTCAGTCTACCTCTGGTCGTG -3'

Sequencing Primer
(F):5'- GGCTGCTCTGCATGGAAC -3'
(R):5'- CTGGAACTCACTTTGTAGACCAGG -3'
Posted On2019-10-24