Incidental Mutation 'R7579:Gldn'
ID586644
Institutional Source Beutler Lab
Gene Symbol Gldn
Ensembl Gene ENSMUSG00000046167
Gene Namegliomedin
SynonymsCRG-L2, Crlg2
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.335) question?
Stock #R7579 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location54286486-54341786 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 54338364 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 400 (T400A)
Ref Sequence ENSEMBL: ENSMUSP00000056080 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056740]
Predicted Effect probably benign
Transcript: ENSMUST00000056740
AA Change: T400A

PolyPhen 2 Score 0.210 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000056080
Gene: ENSMUSG00000046167
AA Change: T400A

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
Pfam:Collagen 136 195 8.3e-11 PFAM
low complexity region 199 211 N/A INTRINSIC
low complexity region 213 221 N/A INTRINSIC
low complexity region 236 261 N/A INTRINSIC
OLF 299 543 1.97e-35 SMART
Meta Mutation Damage Score 0.1990 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 96% (51/53)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele fail to form heminodes without overt neurological abnormalities or alteration in nerve conduction. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsm4 G T 7: 119,693,710 R21L probably benign Het
Adgb T A 10: 10,410,818 R120* probably null Het
Adgra3 C A 5: 49,987,635 A539S probably benign Het
Ank2 A G 3: 126,946,398 S1946P unknown Het
Card6 TTGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGCGGATGAGAGGGCTTAGCATGGGAGGACTG TTGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGCGGATGAGAGGGCTTAGCATGGGAGGACTG 15: 5,098,691 probably benign Het
Cdc20b A T 13: 113,037,048 probably null Het
Cfh T G 1: 140,108,590 D730A possibly damaging Het
Dennd1a T C 2: 37,858,432 H345R probably damaging Het
Dhx36 T C 3: 62,480,873 S614G possibly damaging Het
Dio1 C T 4: 107,292,386 V240I possibly damaging Het
Dnah12 A G 14: 26,770,503 D1200G probably benign Het
Dpy19l4 A T 4: 11,265,909 S680T probably benign Het
Eef2 CCC CCCC 10: 81,178,768 probably null Het
Fcrlb T C 1: 170,907,847 probably null Het
Gad1 T A 2: 70,587,132 I253K possibly damaging Het
Gars A G 6: 55,077,703 D665G probably damaging Het
Gm1110 C A 9: 26,883,826 V455L possibly damaging Het
Gm11444 A G 11: 85,850,243 V30A unknown Het
Gm5134 T C 10: 75,964,437 S51P probably damaging Het
Gprc6a C T 10: 51,626,787 A327T probably benign Het
Gstt2 A T 10: 75,834,185 D34E probably benign Het
Icam2 A G 11: 106,380,763 F78L probably damaging Het
Jakmip1 T G 5: 37,127,458 C630G possibly damaging Het
Kcnu1 A T 8: 25,896,658 N523I probably damaging Het
Klf10 A G 15: 38,297,038 S253P probably benign Het
Mmd2 A T 5: 142,608,606 M1K probably null Het
Mroh2b G T 15: 4,931,061 G759C probably benign Het
Olfr1079 C T 2: 86,538,528 C127Y probably damaging Het
Olfr1493-ps1 T C 19: 13,727,101 L280P probably damaging Het
Olfr1535 A T 13: 21,556,006 N5K probably benign Het
Orc5 A G 5: 22,550,199 F22S possibly damaging Het
Prlr A G 15: 10,328,935 I499V probably benign Het
Ptbp1 A G 10: 79,859,120 N94S probably benign Het
Rassf3 C A 10: 121,476,198 probably benign Het
Rbm33 C T 5: 28,368,266 P455S probably damaging Het
Sgcd C G 11: 47,125,654 G127A possibly damaging Het
Slc22a13 A G 9: 119,195,160 I336T possibly damaging Het
Slc25a31 A T 3: 40,725,040 D312V possibly damaging Het
Slc37a4 G A 9: 44,401,521 S324N probably benign Het
Slco1a5 A G 6: 142,275,481 V13A probably benign Het
Srgap2 T C 1: 131,292,633 H907R probably damaging Het
Supv3l1 C A 10: 62,435,709 V381L possibly damaging Het
Supv3l1 A C 10: 62,435,708 V381G probably damaging Het
Syne1 T C 10: 5,349,324 D977G probably damaging Het
Syt3 T A 7: 44,390,848 Y168* probably null Het
Tshz1 A T 18: 84,014,665 Y539* probably null Het
Ttll13 A G 7: 80,258,233 K501R probably benign Het
Ttn G A 2: 76,782,388 Q17116* probably null Het
Vcan T C 13: 89,692,458 T1656A probably damaging Het
Vmn1r73 G T 7: 11,757,155 C300F probably benign Het
Vmn2r9 T C 5: 108,845,082 K521E probably damaging Het
Zdhhc11 T A 13: 73,982,766 probably benign Het
Zfp760 T C 17: 21,722,926 S361P possibly damaging Het
Zranb2 A G 3: 157,540,672 Y114C probably damaging Het
Other mutations in Gldn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00585:Gldn APN 9 54338464 missense probably damaging 0.99
IGL01778:Gldn APN 9 54334492 splice site probably null
IGL02425:Gldn APN 9 54338721 missense probably damaging 1.00
R2284:Gldn UTSW 9 54286565 nonsense probably null
R2902:Gldn UTSW 9 54335814 missense possibly damaging 0.84
R3055:Gldn UTSW 9 54338523 missense probably damaging 0.96
R3683:Gldn UTSW 9 54338340 missense possibly damaging 0.58
R3684:Gldn UTSW 9 54338340 missense possibly damaging 0.58
R3732:Gldn UTSW 9 54338662 missense possibly damaging 0.76
R3732:Gldn UTSW 9 54338662 missense possibly damaging 0.76
R3733:Gldn UTSW 9 54338662 missense possibly damaging 0.76
R3734:Gldn UTSW 9 54338662 missense possibly damaging 0.76
R4668:Gldn UTSW 9 54332018 nonsense probably null
R5228:Gldn UTSW 9 54334719 missense probably damaging 0.98
R5574:Gldn UTSW 9 54312922 missense probably damaging 1.00
R5773:Gldn UTSW 9 54334491 critical splice donor site probably null
R5926:Gldn UTSW 9 54338438 missense possibly damaging 0.68
R5943:Gldn UTSW 9 54338437 missense possibly damaging 0.81
R6331:Gldn UTSW 9 54286878 missense probably benign 0.32
R6671:Gldn UTSW 9 54338407 missense probably damaging 1.00
R6821:Gldn UTSW 9 54338770 missense probably benign 0.01
R6897:Gldn UTSW 9 54334874 splice site probably null
R7604:Gldn UTSW 9 54338593 missense probably benign
R7705:Gldn UTSW 9 54338692 missense probably benign 0.00
Z1177:Gldn UTSW 9 54286660 missense probably benign 0.37
Predicted Primers PCR Primer
(F):5'- GGAGCACTACAAATCACCAGTG -3'
(R):5'- TGTGTCACGGAGAATGTCCTC -3'

Sequencing Primer
(F):5'- AGTGTCCACCAACATGTGTG -3'
(R):5'- GGAGAATGTCCTCTCATCCAG -3'
Posted On2019-10-24