Incidental Mutation 'R7579:Gprc6a'
ID 586648
Institutional Source Beutler Lab
Gene Symbol Gprc6a
Ensembl Gene ENSMUSG00000019905
Gene Name G protein-coupled receptor, family C, group 6, member A
Synonyms
MMRRC Submission 045633-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R7579 (G1)
Quality Score 225.009
Status Validated
Chromosome 10
Chromosomal Location 51490919-51507554 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 51502883 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Alanine to Threonine at position 327 (A327T)
Ref Sequence ENSEMBL: ENSMUSP00000020062 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020062] [ENSMUST00000218684] [ENSMUST00000219286]
AlphaFold Q8K4Z6
Predicted Effect probably benign
Transcript: ENSMUST00000020062
AA Change: A327T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000020062
Gene: ENSMUSG00000019905
AA Change: A327T

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:ANF_receptor 73 482 2.3e-62 PFAM
Pfam:NCD3G 519 572 5.9e-18 PFAM
Pfam:7tm_3 600 838 2e-49 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000218684
Predicted Effect probably benign
Transcript: ENSMUST00000219286
AA Change: A327T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Meta Mutation Damage Score 0.1295 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 96% (51/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Members of family C of the G protein-coupled receptor (GPCR) superfamily, such as GPRC6A, are characterized by an evolutionarily conserved amino acid-sensing motif linked to an intramembranous 7-transmembrane loop region. Several members of GPCR family C, including GPRC6A, also have a long N-terminal domain (summary by Pi et al., 2005 [PubMed 16199532]).[supplied by OMIM, Nov 2010]
PHENOTYPE: Mice homozygous for a knock-out allele show a metabolic syndrome characterized by impaired bone mineralization, increased fat mass, abnormal renal handling of calcium and phosphorus, fatty liver, glucose intolerance, testicular feminization and abnormal steroidogenesis. [provided by MGI curators]
Allele List at MGI

All alleles(4) : Targeted(4)

Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsm4 G T 7: 119,292,933 (GRCm39) R21L probably benign Het
Adgb T A 10: 10,286,562 (GRCm39) R120* probably null Het
Adgra3 C A 5: 50,144,977 (GRCm39) A539S probably benign Het
Ank2 A G 3: 126,740,047 (GRCm39) S1946P unknown Het
Card6 TTGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGCGGATGAGAGGGCTTAGCATGGGAGGACTG TTGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGCGGATGAGAGGGCTTAGCATGGGAGGACTG 15: 5,128,173 (GRCm39) probably benign Het
Cdc20b A T 13: 113,173,582 (GRCm39) probably null Het
Cfh T G 1: 140,036,328 (GRCm39) D730A possibly damaging Het
Dennd1a T C 2: 37,748,444 (GRCm39) H345R probably damaging Het
Dhx36 T C 3: 62,388,294 (GRCm39) S614G possibly damaging Het
Dio1 C T 4: 107,149,583 (GRCm39) V240I possibly damaging Het
Dnah12 A G 14: 26,492,460 (GRCm39) D1200G probably benign Het
Dpy19l4 A T 4: 11,265,909 (GRCm39) S680T probably benign Het
Eef2 CCC CCCC 10: 81,014,602 (GRCm39) probably null Het
Fcrlb T C 1: 170,735,416 (GRCm39) probably null Het
Gad1 T A 2: 70,417,476 (GRCm39) I253K possibly damaging Het
Gars1 A G 6: 55,054,688 (GRCm39) D665G probably damaging Het
Gldn A G 9: 54,245,648 (GRCm39) T400A probably benign Het
Gm1110 C A 9: 26,795,122 (GRCm39) V455L possibly damaging Het
Gm11444 A G 11: 85,741,069 (GRCm39) V30A unknown Het
Gm5134 T C 10: 75,800,271 (GRCm39) S51P probably damaging Het
Gstt2 A T 10: 75,670,019 (GRCm39) D34E probably benign Het
Icam2 A G 11: 106,271,589 (GRCm39) F78L probably damaging Het
Jakmip1 T G 5: 37,284,802 (GRCm39) C630G possibly damaging Het
Kcnu1 A T 8: 26,386,686 (GRCm39) N523I probably damaging Het
Klf10 A G 15: 38,297,282 (GRCm39) S253P probably benign Het
Mmd2 A T 5: 142,594,361 (GRCm39) M1K probably null Het
Mroh2b G T 15: 4,960,543 (GRCm39) G759C probably benign Het
Or10w3 T C 19: 13,704,465 (GRCm39) L280P probably damaging Het
Or2b7 A T 13: 21,740,176 (GRCm39) N5K probably benign Het
Or8k32 C T 2: 86,368,872 (GRCm39) C127Y probably damaging Het
Orc5 A G 5: 22,755,197 (GRCm39) F22S possibly damaging Het
Prlr A G 15: 10,329,021 (GRCm39) I499V probably benign Het
Ptbp1 A G 10: 79,694,954 (GRCm39) N94S probably benign Het
Rassf3 C A 10: 121,312,103 (GRCm39) probably benign Het
Rbm33 C T 5: 28,573,264 (GRCm39) P455S probably damaging Het
Sgcd C G 11: 47,016,481 (GRCm39) G127A possibly damaging Het
Slc22a13 A G 9: 119,024,226 (GRCm39) I336T possibly damaging Het
Slc25a31 A T 3: 40,679,471 (GRCm39) D312V possibly damaging Het
Slc37a4 G A 9: 44,312,818 (GRCm39) S324N probably benign Het
Slco1a5 A G 6: 142,221,207 (GRCm39) V13A probably benign Het
Srgap2 T C 1: 131,220,371 (GRCm39) H907R probably damaging Het
Supv3l1 A C 10: 62,271,487 (GRCm39) V381G probably damaging Het
Supv3l1 C A 10: 62,271,488 (GRCm39) V381L possibly damaging Het
Syne1 T C 10: 5,299,324 (GRCm39) D977G probably damaging Het
Syt3 T A 7: 44,040,272 (GRCm39) Y168* probably null Het
Tshz1 A T 18: 84,032,790 (GRCm39) Y539* probably null Het
Ttll13 A G 7: 79,907,981 (GRCm39) K501R probably benign Het
Ttn G A 2: 76,612,732 (GRCm39) Q17116* probably null Het
Vcan T C 13: 89,840,577 (GRCm39) T1656A probably damaging Het
Vmn1r73 G T 7: 11,491,082 (GRCm39) C300F probably benign Het
Vmn2r9 T C 5: 108,992,948 (GRCm39) K521E probably damaging Het
Zdhhc11 T A 13: 74,130,885 (GRCm39) probably benign Het
Zfp760 T C 17: 21,941,907 (GRCm39) S361P possibly damaging Het
Zranb2 A G 3: 157,246,309 (GRCm39) Y114C probably damaging Het
Other mutations in Gprc6a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01361:Gprc6a APN 10 51,491,526 (GRCm39) missense probably damaging 1.00
IGL01640:Gprc6a APN 10 51,503,180 (GRCm39) missense probably damaging 0.99
IGL02122:Gprc6a APN 10 51,502,819 (GRCm39) missense probably benign
IGL02317:Gprc6a APN 10 51,497,049 (GRCm39) missense probably benign 0.01
IGL02995:Gprc6a APN 10 51,502,895 (GRCm39) missense probably damaging 1.00
IGL03229:Gprc6a APN 10 51,492,699 (GRCm39) missense probably damaging 1.00
IGL03256:Gprc6a APN 10 51,504,445 (GRCm39) missense possibly damaging 0.77
IGL03290:Gprc6a APN 10 51,491,968 (GRCm39) missense probably damaging 1.00
IGL03393:Gprc6a APN 10 51,491,355 (GRCm39) missense probably damaging 1.00
R0040:Gprc6a UTSW 10 51,491,080 (GRCm39) nonsense probably null
R0040:Gprc6a UTSW 10 51,491,080 (GRCm39) nonsense probably null
R0050:Gprc6a UTSW 10 51,491,485 (GRCm39) missense probably damaging 1.00
R0050:Gprc6a UTSW 10 51,491,485 (GRCm39) missense probably damaging 1.00
R1495:Gprc6a UTSW 10 51,504,533 (GRCm39) missense probably benign 0.01
R1831:Gprc6a UTSW 10 51,491,902 (GRCm39) missense probably benign 0.22
R2108:Gprc6a UTSW 10 51,491,304 (GRCm39) missense probably damaging 1.00
R2159:Gprc6a UTSW 10 51,491,776 (GRCm39) frame shift probably null
R2160:Gprc6a UTSW 10 51,491,776 (GRCm39) frame shift probably null
R2162:Gprc6a UTSW 10 51,491,776 (GRCm39) frame shift probably null
R2229:Gprc6a UTSW 10 51,502,891 (GRCm39) missense possibly damaging 0.50
R3009:Gprc6a UTSW 10 51,504,392 (GRCm39) missense probably benign 0.02
R3709:Gprc6a UTSW 10 51,491,776 (GRCm39) frame shift probably null
R3710:Gprc6a UTSW 10 51,491,776 (GRCm39) frame shift probably null
R3737:Gprc6a UTSW 10 51,503,007 (GRCm39) missense probably benign
R3914:Gprc6a UTSW 10 51,504,371 (GRCm39) missense probably benign 0.00
R3918:Gprc6a UTSW 10 51,491,776 (GRCm39) frame shift probably null
R3964:Gprc6a UTSW 10 51,491,776 (GRCm39) frame shift probably null
R3965:Gprc6a UTSW 10 51,491,776 (GRCm39) frame shift probably null
R3966:Gprc6a UTSW 10 51,491,776 (GRCm39) frame shift probably null
R3973:Gprc6a UTSW 10 51,504,544 (GRCm39) missense possibly damaging 0.93
R3977:Gprc6a UTSW 10 51,497,197 (GRCm39) missense probably benign 0.18
R3978:Gprc6a UTSW 10 51,497,197 (GRCm39) missense probably benign 0.18
R3979:Gprc6a UTSW 10 51,497,197 (GRCm39) missense probably benign 0.18
R4306:Gprc6a UTSW 10 51,492,735 (GRCm39) missense probably damaging 1.00
R4404:Gprc6a UTSW 10 51,504,639 (GRCm39) missense probably benign 0.09
R4405:Gprc6a UTSW 10 51,504,639 (GRCm39) missense probably benign 0.09
R4408:Gprc6a UTSW 10 51,504,639 (GRCm39) missense probably benign 0.09
R4713:Gprc6a UTSW 10 51,507,553 (GRCm39) unclassified probably benign
R4788:Gprc6a UTSW 10 51,491,104 (GRCm39) missense probably benign 0.00
R5248:Gprc6a UTSW 10 51,491,089 (GRCm39) missense probably damaging 1.00
R5263:Gprc6a UTSW 10 51,502,900 (GRCm39) missense probably damaging 1.00
R5436:Gprc6a UTSW 10 51,502,798 (GRCm39) missense probably benign
R5721:Gprc6a UTSW 10 51,491,076 (GRCm39) missense probably benign 0.06
R6061:Gprc6a UTSW 10 51,491,907 (GRCm39) missense probably damaging 1.00
R6092:Gprc6a UTSW 10 51,491,173 (GRCm39) missense probably damaging 1.00
R6132:Gprc6a UTSW 10 51,491,356 (GRCm39) missense possibly damaging 0.89
R6162:Gprc6a UTSW 10 51,491,008 (GRCm39) missense probably benign 0.44
R6207:Gprc6a UTSW 10 51,502,931 (GRCm39) missense probably benign 0.36
R6497:Gprc6a UTSW 10 51,491,797 (GRCm39) missense probably benign 0.05
R6717:Gprc6a UTSW 10 51,491,233 (GRCm39) missense probably damaging 1.00
R6789:Gprc6a UTSW 10 51,507,412 (GRCm39) missense probably damaging 1.00
R6807:Gprc6a UTSW 10 51,502,841 (GRCm39) nonsense probably null
R7000:Gprc6a UTSW 10 51,491,143 (GRCm39) missense probably benign 0.34
R7019:Gprc6a UTSW 10 51,507,508 (GRCm39) missense possibly damaging 0.68
R7143:Gprc6a UTSW 10 51,490,986 (GRCm39) missense probably benign
R7173:Gprc6a UTSW 10 51,504,595 (GRCm39) missense probably benign 0.01
R7736:Gprc6a UTSW 10 51,491,549 (GRCm39) missense possibly damaging 0.82
R7920:Gprc6a UTSW 10 51,491,026 (GRCm39) missense probably benign 0.02
R8273:Gprc6a UTSW 10 51,507,370 (GRCm39) missense probably benign
R8329:Gprc6a UTSW 10 51,503,355 (GRCm39) nonsense probably null
R8517:Gprc6a UTSW 10 51,507,337 (GRCm39) missense probably benign 0.00
R8723:Gprc6a UTSW 10 51,491,518 (GRCm39) missense probably damaging 1.00
R8815:Gprc6a UTSW 10 51,497,079 (GRCm39) missense probably benign 0.00
R8829:Gprc6a UTSW 10 51,491,295 (GRCm39) missense probably damaging 0.99
R9151:Gprc6a UTSW 10 51,497,182 (GRCm39) missense possibly damaging 0.94
R9420:Gprc6a UTSW 10 51,491,506 (GRCm39) missense probably damaging 0.99
R9753:Gprc6a UTSW 10 51,504,364 (GRCm39) missense probably benign 0.20
R9766:Gprc6a UTSW 10 51,491,884 (GRCm39) missense probably damaging 1.00
R9790:Gprc6a UTSW 10 51,491,395 (GRCm39) missense probably damaging 0.98
R9791:Gprc6a UTSW 10 51,491,395 (GRCm39) missense probably damaging 0.98
Z1177:Gprc6a UTSW 10 51,491,305 (GRCm39) missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TGCCAGAGGAAATCATTTCTCTTG -3'
(R):5'- GCAGAAGCCCAGGTTAATGTC -3'

Sequencing Primer
(F):5'- AGTGTCATAGGTCAAAGTTGCC -3'
(R):5'- CAGAAGCCCAGGTTAATGTCATTGTG -3'
Posted On 2019-10-24