Incidental Mutation 'R7579:Gm5134'
ID586652
Institutional Source Beutler Lab
Gene Symbol Gm5134
Ensembl Gene ENSMUSG00000033255
Gene Namepredicted gene 5134
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.108) question?
Stock #R7579 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location75954514-76009591 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 75964437 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 51 (S51P)
Ref Sequence ENSEMBL: ENSMUSP00000097172 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099577]
Predicted Effect probably damaging
Transcript: ENSMUST00000099577
AA Change: S51P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000097172
Gene: ENSMUSG00000033255
AA Change: S51P

DomainStartEndE-ValueType
Pfam:SSF 32 466 2.9e-119 PFAM
transmembrane domain 500 522 N/A INTRINSIC
transmembrane domain 651 670 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 96% (51/53)
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsm4 G T 7: 119,693,710 R21L probably benign Het
Adgb T A 10: 10,410,818 R120* probably null Het
Adgra3 C A 5: 49,987,635 A539S probably benign Het
Ank2 A G 3: 126,946,398 S1946P unknown Het
Card6 TTGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGCGGATGAGAGGGCTTAGCATGGGAGGACTG TTGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGCGGATGAGAGGGCTTAGCATGGGAGGACTG 15: 5,098,691 probably benign Het
Cdc20b A T 13: 113,037,048 probably null Het
Cfh T G 1: 140,108,590 D730A possibly damaging Het
Dennd1a T C 2: 37,858,432 H345R probably damaging Het
Dhx36 T C 3: 62,480,873 S614G possibly damaging Het
Dio1 C T 4: 107,292,386 V240I possibly damaging Het
Dnah12 A G 14: 26,770,503 D1200G probably benign Het
Dpy19l4 A T 4: 11,265,909 S680T probably benign Het
Eef2 CCC CCCC 10: 81,178,768 probably null Het
Fcrlb T C 1: 170,907,847 probably null Het
Gad1 T A 2: 70,587,132 I253K possibly damaging Het
Gars A G 6: 55,077,703 D665G probably damaging Het
Gldn A G 9: 54,338,364 T400A probably benign Het
Gm1110 C A 9: 26,883,826 V455L possibly damaging Het
Gm11444 A G 11: 85,850,243 V30A unknown Het
Gprc6a C T 10: 51,626,787 A327T probably benign Het
Gstt2 A T 10: 75,834,185 D34E probably benign Het
Icam2 A G 11: 106,380,763 F78L probably damaging Het
Jakmip1 T G 5: 37,127,458 C630G possibly damaging Het
Kcnu1 A T 8: 25,896,658 N523I probably damaging Het
Klf10 A G 15: 38,297,038 S253P probably benign Het
Mmd2 A T 5: 142,608,606 M1K probably null Het
Mroh2b G T 15: 4,931,061 G759C probably benign Het
Olfr1079 C T 2: 86,538,528 C127Y probably damaging Het
Olfr1493-ps1 T C 19: 13,727,101 L280P probably damaging Het
Olfr1535 A T 13: 21,556,006 N5K probably benign Het
Orc5 A G 5: 22,550,199 F22S possibly damaging Het
Prlr A G 15: 10,328,935 I499V probably benign Het
Ptbp1 A G 10: 79,859,120 N94S probably benign Het
Rassf3 C A 10: 121,476,198 probably benign Het
Rbm33 C T 5: 28,368,266 P455S probably damaging Het
Sgcd C G 11: 47,125,654 G127A possibly damaging Het
Slc22a13 A G 9: 119,195,160 I336T possibly damaging Het
Slc25a31 A T 3: 40,725,040 D312V possibly damaging Het
Slc37a4 G A 9: 44,401,521 S324N probably benign Het
Slco1a5 A G 6: 142,275,481 V13A probably benign Het
Srgap2 T C 1: 131,292,633 H907R probably damaging Het
Supv3l1 A C 10: 62,435,708 V381G probably damaging Het
Supv3l1 C A 10: 62,435,709 V381L possibly damaging Het
Syne1 T C 10: 5,349,324 D977G probably damaging Het
Syt3 T A 7: 44,390,848 Y168* probably null Het
Tshz1 A T 18: 84,014,665 Y539* probably null Het
Ttll13 A G 7: 80,258,233 K501R probably benign Het
Ttn G A 2: 76,782,388 Q17116* probably null Het
Vcan T C 13: 89,692,458 T1656A probably damaging Het
Vmn1r73 G T 7: 11,757,155 C300F probably benign Het
Vmn2r9 T C 5: 108,845,082 K521E probably damaging Het
Zdhhc11 T A 13: 73,982,766 probably benign Het
Zfp760 T C 17: 21,722,926 S361P possibly damaging Het
Zranb2 A G 3: 157,540,672 Y114C probably damaging Het
Other mutations in Gm5134
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00941:Gm5134 APN 10 76000421 missense possibly damaging 0.70
IGL01371:Gm5134 APN 10 76004747 missense probably damaging 0.99
IGL02140:Gm5134 APN 10 75986111 missense probably benign 0.03
IGL02197:Gm5134 APN 10 75954702 critical splice donor site probably null
IGL02233:Gm5134 APN 10 76008500 critical splice acceptor site probably null
IGL02612:Gm5134 APN 10 75992489 missense probably damaging 1.00
IGL02896:Gm5134 APN 10 75974224 missense possibly damaging 0.82
R0021:Gm5134 UTSW 10 75993884 missense probably damaging 1.00
R0021:Gm5134 UTSW 10 75993884 missense probably damaging 1.00
R0035:Gm5134 UTSW 10 75993864 missense probably benign 0.01
R0035:Gm5134 UTSW 10 75993864 missense probably benign 0.01
R0110:Gm5134 UTSW 10 75974245 missense probably benign 0.03
R0499:Gm5134 UTSW 10 75992525 missense probably benign 0.00
R0510:Gm5134 UTSW 10 75974245 missense probably benign 0.03
R1429:Gm5134 UTSW 10 75978381 missense probably damaging 1.00
R1726:Gm5134 UTSW 10 75992527 missense possibly damaging 0.83
R1918:Gm5134 UTSW 10 75976346 missense possibly damaging 0.70
R1956:Gm5134 UTSW 10 76004846 missense possibly damaging 0.89
R1993:Gm5134 UTSW 10 75966393 missense probably damaging 0.96
R2049:Gm5134 UTSW 10 76004884 missense possibly damaging 0.92
R2188:Gm5134 UTSW 10 75995836 missense probably damaging 1.00
R3551:Gm5134 UTSW 10 76000447 missense probably benign 0.08
R4074:Gm5134 UTSW 10 76008531 missense probably damaging 1.00
R4435:Gm5134 UTSW 10 75995824 missense probably damaging 1.00
R4466:Gm5134 UTSW 10 76008575 missense probably benign 0.00
R5180:Gm5134 UTSW 10 75976366 missense probably damaging 1.00
R5446:Gm5134 UTSW 10 75995836 missense probably damaging 1.00
R5601:Gm5134 UTSW 10 75985952 missense probably damaging 0.98
R5627:Gm5134 UTSW 10 75986108 missense possibly damaging 0.93
R5777:Gm5134 UTSW 10 76004760 missense probably benign 0.00
R5867:Gm5134 UTSW 10 76008616 missense probably benign 0.00
R6145:Gm5134 UTSW 10 75995839 missense probably damaging 0.99
R6232:Gm5134 UTSW 10 75986025 missense possibly damaging 0.95
R6271:Gm5134 UTSW 10 75995809 missense probably benign 0.32
R6329:Gm5134 UTSW 10 75954660 missense possibly damaging 0.68
R6723:Gm5134 UTSW 10 76008619 missense probably benign
R7049:Gm5134 UTSW 10 75992458 missense probably damaging 0.97
R7305:Gm5134 UTSW 10 76000399 missense probably damaging 1.00
X0050:Gm5134 UTSW 10 75992510 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCCTCGGGCACAATTTCTG -3'
(R):5'- CAAGGTGTCTTTAACAGTCACTCG -3'

Sequencing Primer
(F):5'- TGTGCCCAAATTCACTAAGCGG -3'
(R):5'- CGAAATGCTCAGGTAGAGA -3'
Posted On2019-10-24