Incidental Mutation 'R7579:Mroh2b'
ID586662
Institutional Source Beutler Lab
Gene Symbol Mroh2b
Ensembl Gene ENSMUSG00000022155
Gene Namemaestro heat-like repeat family member 2B
Synonyms4930455B06Rik, Heatr7b2
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.132) question?
Stock #R7579 (G1)
Quality Score225.009
Status Validated
Chromosome15
Chromosomal Location4898737-4962205 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 4931061 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Cysteine at position 759 (G759C)
Ref Sequence ENSEMBL: ENSMUSP00000036148 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045736]
Predicted Effect probably benign
Transcript: ENSMUST00000045736
AA Change: G759C

PolyPhen 2 Score 0.094 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000036148
Gene: ENSMUSG00000022155
AA Change: G759C

DomainStartEndE-ValueType
low complexity region 124 135 N/A INTRINSIC
low complexity region 824 842 N/A INTRINSIC
SCOP:d1gw5a_ 937 1443 7e-15 SMART
Meta Mutation Damage Score 0.1226 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 96% (51/53)
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsm4 G T 7: 119,693,710 R21L probably benign Het
Adgb T A 10: 10,410,818 R120* probably null Het
Adgra3 C A 5: 49,987,635 A539S probably benign Het
Ank2 A G 3: 126,946,398 S1946P unknown Het
Card6 TTGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGCGGATGAGAGGGCTTAGCATGGGAGGACTG TTGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGCGGATGAGAGGGCTTAGCATGGGAGGACTG 15: 5,098,691 probably benign Het
Cdc20b A T 13: 113,037,048 probably null Het
Cfh T G 1: 140,108,590 D730A possibly damaging Het
Dennd1a T C 2: 37,858,432 H345R probably damaging Het
Dhx36 T C 3: 62,480,873 S614G possibly damaging Het
Dio1 C T 4: 107,292,386 V240I possibly damaging Het
Dnah12 A G 14: 26,770,503 D1200G probably benign Het
Dpy19l4 A T 4: 11,265,909 S680T probably benign Het
Eef2 CCC CCCC 10: 81,178,768 probably null Het
Fcrlb T C 1: 170,907,847 probably null Het
Gad1 T A 2: 70,587,132 I253K possibly damaging Het
Gars A G 6: 55,077,703 D665G probably damaging Het
Gldn A G 9: 54,338,364 T400A probably benign Het
Gm1110 C A 9: 26,883,826 V455L possibly damaging Het
Gm11444 A G 11: 85,850,243 V30A unknown Het
Gm5134 T C 10: 75,964,437 S51P probably damaging Het
Gprc6a C T 10: 51,626,787 A327T probably benign Het
Gstt2 A T 10: 75,834,185 D34E probably benign Het
Icam2 A G 11: 106,380,763 F78L probably damaging Het
Jakmip1 T G 5: 37,127,458 C630G possibly damaging Het
Kcnu1 A T 8: 25,896,658 N523I probably damaging Het
Klf10 A G 15: 38,297,038 S253P probably benign Het
Mmd2 A T 5: 142,608,606 M1K probably null Het
Olfr1079 C T 2: 86,538,528 C127Y probably damaging Het
Olfr1493-ps1 T C 19: 13,727,101 L280P probably damaging Het
Olfr1535 A T 13: 21,556,006 N5K probably benign Het
Orc5 A G 5: 22,550,199 F22S possibly damaging Het
Prlr A G 15: 10,328,935 I499V probably benign Het
Ptbp1 A G 10: 79,859,120 N94S probably benign Het
Rassf3 C A 10: 121,476,198 probably benign Het
Rbm33 C T 5: 28,368,266 P455S probably damaging Het
Sgcd C G 11: 47,125,654 G127A possibly damaging Het
Slc22a13 A G 9: 119,195,160 I336T possibly damaging Het
Slc25a31 A T 3: 40,725,040 D312V possibly damaging Het
Slc37a4 G A 9: 44,401,521 S324N probably benign Het
Slco1a5 A G 6: 142,275,481 V13A probably benign Het
Srgap2 T C 1: 131,292,633 H907R probably damaging Het
Supv3l1 A C 10: 62,435,708 V381G probably damaging Het
Supv3l1 C A 10: 62,435,709 V381L possibly damaging Het
Syne1 T C 10: 5,349,324 D977G probably damaging Het
Syt3 T A 7: 44,390,848 Y168* probably null Het
Tshz1 A T 18: 84,014,665 Y539* probably null Het
Ttll13 A G 7: 80,258,233 K501R probably benign Het
Ttn G A 2: 76,782,388 Q17116* probably null Het
Vcan T C 13: 89,692,458 T1656A probably damaging Het
Vmn1r73 G T 7: 11,757,155 C300F probably benign Het
Vmn2r9 T C 5: 108,845,082 K521E probably damaging Het
Zdhhc11 T A 13: 73,982,766 probably benign Het
Zfp760 T C 17: 21,722,926 S361P possibly damaging Het
Zranb2 A G 3: 157,540,672 Y114C probably damaging Het
Other mutations in Mroh2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00503:Mroh2b APN 15 4899197 missense probably benign
IGL00507:Mroh2b APN 15 4962127 missense probably damaging 1.00
IGL00548:Mroh2b APN 15 4931316 missense probably benign 0.35
IGL00902:Mroh2b APN 15 4915222 missense probably damaging 1.00
IGL00944:Mroh2b APN 15 4951127 splice site probably benign
IGL00954:Mroh2b APN 15 4903054 missense probably damaging 0.99
IGL01015:Mroh2b APN 15 4941542 missense probably damaging 1.00
IGL01134:Mroh2b APN 15 4915152 missense probably benign 0.00
IGL01337:Mroh2b APN 15 4905024 missense probably benign 0.38
IGL01780:Mroh2b APN 15 4912000 missense probably benign 0.01
IGL01919:Mroh2b APN 15 4923688 missense probably benign 0.10
IGL02069:Mroh2b APN 15 4904324 splice site probably benign
IGL02146:Mroh2b APN 15 4951294 splice site probably null
IGL02221:Mroh2b APN 15 4923641 missense probably damaging 1.00
IGL02281:Mroh2b APN 15 4952263 missense probably benign 0.04
IGL02350:Mroh2b APN 15 4912000 missense probably benign 0.01
IGL02357:Mroh2b APN 15 4912000 missense probably benign 0.01
IGL02401:Mroh2b APN 15 4900501 missense possibly damaging 0.71
IGL02427:Mroh2b APN 15 4951560 splice site probably benign
IGL02432:Mroh2b APN 15 4914186 missense probably benign
IGL02582:Mroh2b APN 15 4908515 missense probably damaging 0.98
IGL02632:Mroh2b APN 15 4931101 missense probably damaging 0.99
IGL02741:Mroh2b APN 15 4905632 missense probably benign
IGL02811:Mroh2b APN 15 4915236 missense possibly damaging 0.55
IGL02826:Mroh2b APN 15 4962148 missense probably damaging 0.99
IGL03412:Mroh2b APN 15 4944372 missense probably benign 0.14
PIT4468001:Mroh2b UTSW 15 4912812 missense probably damaging 1.00
R0024:Mroh2b UTSW 15 4925627 missense probably damaging 1.00
R0333:Mroh2b UTSW 15 4931118 missense probably damaging 1.00
R0433:Mroh2b UTSW 15 4941634 missense probably benign 0.01
R0530:Mroh2b UTSW 15 4934395 missense probably damaging 0.97
R1411:Mroh2b UTSW 15 4918317 missense probably damaging 1.00
R1457:Mroh2b UTSW 15 4925684 missense probably damaging 1.00
R1466:Mroh2b UTSW 15 4925684 missense probably damaging 1.00
R1466:Mroh2b UTSW 15 4925684 missense probably damaging 1.00
R1472:Mroh2b UTSW 15 4948655 missense probably benign 0.00
R1525:Mroh2b UTSW 15 4951130 splice site probably null
R1584:Mroh2b UTSW 15 4925684 missense probably damaging 1.00
R1605:Mroh2b UTSW 15 4945090 missense probably benign 0.08
R1657:Mroh2b UTSW 15 4931043 nonsense probably null
R1671:Mroh2b UTSW 15 4951294 splice site probably null
R1698:Mroh2b UTSW 15 4914140 missense probably benign 0.02
R2002:Mroh2b UTSW 15 4925684 missense probably damaging 1.00
R2005:Mroh2b UTSW 15 4917158 missense probably damaging 1.00
R2077:Mroh2b UTSW 15 4944966 missense probably damaging 1.00
R2179:Mroh2b UTSW 15 4921446 critical splice donor site probably null
R2183:Mroh2b UTSW 15 4918225 splice site probably null
R3713:Mroh2b UTSW 15 4943649 missense probably benign 0.01
R3714:Mroh2b UTSW 15 4943649 missense probably benign 0.01
R3747:Mroh2b UTSW 15 4952246 nonsense probably null
R3748:Mroh2b UTSW 15 4952246 nonsense probably null
R3749:Mroh2b UTSW 15 4952246 nonsense probably null
R3750:Mroh2b UTSW 15 4952246 nonsense probably null
R3792:Mroh2b UTSW 15 4923620 missense probably damaging 1.00
R3872:Mroh2b UTSW 15 4925061 nonsense probably null
R4021:Mroh2b UTSW 15 4925100 missense possibly damaging 0.75
R4329:Mroh2b UTSW 15 4931379 missense probably damaging 0.99
R4456:Mroh2b UTSW 15 4947925 missense probably benign 0.21
R4592:Mroh2b UTSW 15 4918290 missense probably damaging 1.00
R4836:Mroh2b UTSW 15 4904270 missense probably damaging 1.00
R5050:Mroh2b UTSW 15 4900450 missense possibly damaging 0.82
R5230:Mroh2b UTSW 15 4941522 missense probably benign 0.07
R5342:Mroh2b UTSW 15 4914133 nonsense probably null
R5353:Mroh2b UTSW 15 4917178 missense probably damaging 1.00
R5368:Mroh2b UTSW 15 4905572 missense probably damaging 1.00
R5424:Mroh2b UTSW 15 4941612 missense probably damaging 0.98
R5484:Mroh2b UTSW 15 4908981 missense possibly damaging 0.92
R5999:Mroh2b UTSW 15 4912884 splice site probably null
R6046:Mroh2b UTSW 15 4951281 missense probably benign 0.01
R6081:Mroh2b UTSW 15 4944377 missense probably damaging 1.00
R6162:Mroh2b UTSW 15 4915225 missense probably damaging 1.00
R6165:Mroh2b UTSW 15 4918350 missense probably benign 0.23
R6240:Mroh2b UTSW 15 4934644 missense probably benign 0.38
R6487:Mroh2b UTSW 15 4947239 missense probably damaging 1.00
R6539:Mroh2b UTSW 15 4905574 missense probably damaging 1.00
R6616:Mroh2b UTSW 15 4953282 missense probably benign 0.36
R6663:Mroh2b UTSW 15 4947935 missense probably benign 0.21
R6820:Mroh2b UTSW 15 4953274 missense probably damaging 1.00
R6900:Mroh2b UTSW 15 4908987 missense probably benign 0.00
R6990:Mroh2b UTSW 15 4912802 missense possibly damaging 0.55
R7067:Mroh2b UTSW 15 4900504 missense probably benign 0.35
R7092:Mroh2b UTSW 15 4934678 missense possibly damaging 0.92
R7102:Mroh2b UTSW 15 4948003 missense probably benign 0.06
R7264:Mroh2b UTSW 15 4921362 missense possibly damaging 0.81
R7436:Mroh2b UTSW 15 4941554 missense probably benign 0.21
R7462:Mroh2b UTSW 15 4908627 missense probably damaging 1.00
R7529:Mroh2b UTSW 15 4949009 missense probably damaging 1.00
R7575:Mroh2b UTSW 15 4934605 missense probably damaging 1.00
R7605:Mroh2b UTSW 15 4945023 missense probably damaging 1.00
R7624:Mroh2b UTSW 15 4917131 missense probably damaging 1.00
R7797:Mroh2b UTSW 15 4949105 missense probably benign 0.36
R7848:Mroh2b UTSW 15 4938379 nonsense probably null
R7952:Mroh2b UTSW 15 4951211 missense probably damaging 1.00
R7995:Mroh2b UTSW 15 4921357 nonsense probably null
R8088:Mroh2b UTSW 15 4900503 missense possibly damaging 0.57
R8207:Mroh2b UTSW 15 4938410 missense possibly damaging 0.95
R8242:Mroh2b UTSW 15 4909040 missense probably benign 0.04
R8248:Mroh2b UTSW 15 4931104 missense probably benign 0.40
R8258:Mroh2b UTSW 15 4911909 missense probably benign 0.01
R8259:Mroh2b UTSW 15 4911909 missense probably benign 0.01
R8304:Mroh2b UTSW 15 4925637 missense probably damaging 0.99
R8316:Mroh2b UTSW 15 4951264 nonsense probably null
R8345:Mroh2b UTSW 15 4944326 missense probably benign 0.09
R8507:Mroh2b UTSW 15 4949090 missense probably damaging 1.00
X0067:Mroh2b UTSW 15 4951591 missense possibly damaging 0.90
Z1177:Mroh2b UTSW 15 4905005 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATGTGGGAGGAGATTGACATTC -3'
(R):5'- GGGTCTTTGCCTTCCATCAG -3'

Sequencing Primer
(F):5'- AATTTTCCTGCTACTGAGACCCTAGG -3'
(R):5'- CAGAAAGATGCAAGACATGTGTTTC -3'
Posted On2019-10-24