Incidental Mutation 'R7579:Zfp760'
ID586666
Institutional Source Beutler Lab
Gene Symbol Zfp760
Ensembl Gene ENSMUSG00000067928
Gene Namezinc finger protein 760
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.127) question?
Stock #R7579 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location21707741-21725636 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 21722926 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 361 (S361P)
Ref Sequence ENSEMBL: ENSMUSP00000073038 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073312]
Predicted Effect possibly damaging
Transcript: ENSMUST00000073312
AA Change: S361P

PolyPhen 2 Score 0.930 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000073038
Gene: ENSMUSG00000067928
AA Change: S361P

DomainStartEndE-ValueType
KRAB 8 69 3.62e-21 SMART
ZnF_C2H2 183 202 1.78e2 SMART
ZnF_C2H2 208 230 1.69e-3 SMART
ZnF_C2H2 236 258 4.54e-4 SMART
ZnF_C2H2 264 286 2.79e-4 SMART
ZnF_C2H2 292 314 1.1e-2 SMART
ZnF_C2H2 320 342 2.71e-2 SMART
ZnF_C2H2 348 370 7.9e-4 SMART
ZnF_C2H2 376 398 1.72e-4 SMART
ZnF_C2H2 404 426 1.14e0 SMART
ZnF_C2H2 432 454 4.05e-1 SMART
ZnF_C2H2 460 482 5.14e-3 SMART
ZnF_C2H2 488 510 1.18e-2 SMART
ZnF_C2H2 516 538 1.95e-3 SMART
ZnF_C2H2 544 566 1.82e-3 SMART
ZnF_C2H2 572 594 4.17e-3 SMART
ZnF_C2H2 600 622 1.04e-3 SMART
ZnF_C2H2 628 650 1.28e-3 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 96% (51/53)
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsm4 G T 7: 119,693,710 R21L probably benign Het
Adgb T A 10: 10,410,818 R120* probably null Het
Adgra3 C A 5: 49,987,635 A539S probably benign Het
Ank2 A G 3: 126,946,398 S1946P unknown Het
Card6 TTGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGCGGATGAGAGGGCTTAGCATGGGAGGACTG TTGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGCGGATGAGAGGGCTTAGCATGGGAGGACTG 15: 5,098,691 probably benign Het
Cdc20b A T 13: 113,037,048 probably null Het
Cfh T G 1: 140,108,590 D730A possibly damaging Het
Dennd1a T C 2: 37,858,432 H345R probably damaging Het
Dhx36 T C 3: 62,480,873 S614G possibly damaging Het
Dio1 C T 4: 107,292,386 V240I possibly damaging Het
Dnah12 A G 14: 26,770,503 D1200G probably benign Het
Dpy19l4 A T 4: 11,265,909 S680T probably benign Het
Eef2 CCC CCCC 10: 81,178,768 probably null Het
Fcrlb T C 1: 170,907,847 probably null Het
Gad1 T A 2: 70,587,132 I253K possibly damaging Het
Gars A G 6: 55,077,703 D665G probably damaging Het
Gldn A G 9: 54,338,364 T400A probably benign Het
Gm1110 C A 9: 26,883,826 V455L possibly damaging Het
Gm11444 A G 11: 85,850,243 V30A unknown Het
Gm5134 T C 10: 75,964,437 S51P probably damaging Het
Gprc6a C T 10: 51,626,787 A327T probably benign Het
Gstt2 A T 10: 75,834,185 D34E probably benign Het
Icam2 A G 11: 106,380,763 F78L probably damaging Het
Jakmip1 T G 5: 37,127,458 C630G possibly damaging Het
Kcnu1 A T 8: 25,896,658 N523I probably damaging Het
Klf10 A G 15: 38,297,038 S253P probably benign Het
Mmd2 A T 5: 142,608,606 M1K probably null Het
Mroh2b G T 15: 4,931,061 G759C probably benign Het
Olfr1079 C T 2: 86,538,528 C127Y probably damaging Het
Olfr1493-ps1 T C 19: 13,727,101 L280P probably damaging Het
Olfr1535 A T 13: 21,556,006 N5K probably benign Het
Orc5 A G 5: 22,550,199 F22S possibly damaging Het
Prlr A G 15: 10,328,935 I499V probably benign Het
Ptbp1 A G 10: 79,859,120 N94S probably benign Het
Rassf3 C A 10: 121,476,198 probably benign Het
Rbm33 C T 5: 28,368,266 P455S probably damaging Het
Sgcd C G 11: 47,125,654 G127A possibly damaging Het
Slc22a13 A G 9: 119,195,160 I336T possibly damaging Het
Slc25a31 A T 3: 40,725,040 D312V possibly damaging Het
Slc37a4 G A 9: 44,401,521 S324N probably benign Het
Slco1a5 A G 6: 142,275,481 V13A probably benign Het
Srgap2 T C 1: 131,292,633 H907R probably damaging Het
Supv3l1 A C 10: 62,435,708 V381G probably damaging Het
Supv3l1 C A 10: 62,435,709 V381L possibly damaging Het
Syne1 T C 10: 5,349,324 D977G probably damaging Het
Syt3 T A 7: 44,390,848 Y168* probably null Het
Tshz1 A T 18: 84,014,665 Y539* probably null Het
Ttll13 A G 7: 80,258,233 K501R probably benign Het
Ttn G A 2: 76,782,388 Q17116* probably null Het
Vcan T C 13: 89,692,458 T1656A probably damaging Het
Vmn1r73 G T 7: 11,757,155 C300F probably benign Het
Vmn2r9 T C 5: 108,845,082 K521E probably damaging Het
Zdhhc11 T A 13: 73,982,766 probably benign Het
Zranb2 A G 3: 157,540,672 Y114C probably damaging Het
Other mutations in Zfp760
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00472:Zfp760 APN 17 21723476 missense possibly damaging 0.75
IGL00862:Zfp760 APN 17 21722284 missense probably benign 0.00
IGL02198:Zfp760 APN 17 21722212 missense probably benign 0.00
R0478:Zfp760 UTSW 17 21722014 nonsense probably null
R0835:Zfp760 UTSW 17 21723578 missense possibly damaging 0.63
R1191:Zfp760 UTSW 17 21723305 missense probably damaging 1.00
R1760:Zfp760 UTSW 17 21722330 missense probably damaging 1.00
R2698:Zfp760 UTSW 17 21720954 missense probably damaging 0.99
R3722:Zfp760 UTSW 17 21722162 missense probably damaging 1.00
R4561:Zfp760 UTSW 17 21723667 missense probably benign 0.00
R4700:Zfp760 UTSW 17 21722407 missense probably benign 0.01
R4859:Zfp760 UTSW 17 21723530 missense probably damaging 0.97
R4859:Zfp760 UTSW 17 21723535 nonsense probably null
R4897:Zfp760 UTSW 17 21723248 missense probably benign 0.02
R6675:Zfp760 UTSW 17 21723010 missense possibly damaging 0.92
R7286:Zfp760 UTSW 17 21722779 missense probably benign 0.04
R7336:Zfp760 UTSW 17 21723833 missense unknown
R7356:Zfp760 UTSW 17 21722620 missense probably benign
R7369:Zfp760 UTSW 17 21723233 missense probably benign 0.00
R7504:Zfp760 UTSW 17 21722674 missense probably damaging 0.97
R7553:Zfp760 UTSW 17 21722891 missense possibly damaging 0.82
R7577:Zfp760 UTSW 17 21722261 nonsense probably null
R7608:Zfp760 UTSW 17 21722816 missense probably benign 0.00
X0057:Zfp760 UTSW 17 21723682 missense possibly damaging 0.80
Predicted Primers PCR Primer
(F):5'- AAAGCCCATTGCAGAATCCA -3'
(R):5'- CTGATGTCTTTTAAGAGCTGTGCA -3'

Sequencing Primer
(F):5'- AGGCTTTTCACGGTTATCTAGAC -3'
(R):5'- TTAAGAGCTGTGCATTGGGTAAAG -3'
Posted On2019-10-24