Incidental Mutation 'R7580:Rap1gap'
ID586679
Institutional Source Beutler Lab
Gene Symbol Rap1gap
Ensembl Gene ENSMUSG00000041351
Gene NameRap1 GTPase-activating protein
Synonyms1300019I11Rik, 2310004O14Rik, Rap1ga1
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7580 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location137664726-137729861 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 137719982 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 413 (F413L)
Ref Sequence ENSEMBL: ENSMUSP00000095448 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047243] [ENSMUST00000097837] [ENSMUST00000105835] [ENSMUST00000141306] [ENSMUST00000150928] [ENSMUST00000152567]
Predicted Effect possibly damaging
Transcript: ENSMUST00000047243
AA Change: F446L

PolyPhen 2 Score 0.954 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000042473
Gene: ENSMUSG00000041351
AA Change: F446L

DomainStartEndE-ValueType
GoLoco 59 81 4.94e-10 SMART
Pfam:Rap_GAP 274 461 1.4e-64 PFAM
low complexity region 485 495 N/A INTRINSIC
low complexity region 630 641 N/A INTRINSIC
low complexity region 680 695 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000097837
AA Change: F413L

PolyPhen 2 Score 0.937 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000095448
Gene: ENSMUSG00000041351
AA Change: F413L

DomainStartEndE-ValueType
low complexity region 4 16 N/A INTRINSIC
GoLoco 26 48 4.94e-10 SMART
Pfam:Rap_GAP 241 428 1.2e-64 PFAM
low complexity region 452 462 N/A INTRINSIC
low complexity region 597 608 N/A INTRINSIC
low complexity region 647 662 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000105835
AA Change: F446L

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000101461
Gene: ENSMUSG00000041351
AA Change: F446L

DomainStartEndE-ValueType
GoLoco 59 81 4.94e-10 SMART
Pfam:Rap_GAP 274 455 4.5e-66 PFAM
low complexity region 485 495 N/A INTRINSIC
low complexity region 630 641 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000141306
AA Change: F102L

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000122315
Gene: ENSMUSG00000041351
AA Change: F102L

DomainStartEndE-ValueType
Pfam:Rap_GAP 1 117 1.4e-32 PFAM
low complexity region 141 151 N/A INTRINSIC
low complexity region 312 323 N/A INTRINSIC
low complexity region 362 377 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000150928
SMART Domains Protein: ENSMUSP00000123561
Gene: ENSMUSG00000041351

DomainStartEndE-ValueType
GoLoco 59 81 4.94e-10 SMART
Pfam:Rap_GAP 199 241 1.3e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000152567
SMART Domains Protein: ENSMUSP00000115391
Gene: ENSMUSG00000041351

DomainStartEndE-ValueType
GoLoco 47 69 4.94e-10 SMART
PDB:1SRQ|D 127 165 4e-20 PDB
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (54/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a type of GTPase-activating-protein (GAP) that down-regulates the activity of the ras-related RAP1 protein. RAP1 acts as a molecular switch by cycling between an inactive GDP-bound form and an active GTP-bound form. The product of this gene, RAP1GAP, promotes the hydrolysis of bound GTP and hence returns RAP1 to the inactive state whereas other proteins, guanine nucleotide exchange factors (GEFs), act as RAP1 activators by facilitating the conversion of RAP1 from the GDP- to the GTP-bound form. In general, ras subfamily proteins, such as RAP1, play key roles in receptor-linked signaling pathways that control cell growth and differentiation. RAP1 plays a role in diverse processes such as cell proliferation, adhesion, differentiation, and embryogenesis. Alternative splicing results in multiple transcript variants encoding distinct proteins. [provided by RefSeq, Aug 2011]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930486L24Rik T A 13: 60,845,226 Y213F probably damaging Het
Adamdec1 A G 14: 68,565,531 S462P probably benign Het
Adamtsl1 T A 4: 86,054,064 C3S possibly damaging Het
Bag1 C T 4: 40,947,836 E123K probably benign Het
Brip1 A G 11: 86,157,601 L305P probably damaging Het
Cage1 T A 13: 38,022,724 I382F possibly damaging Het
Cfap52 T A 11: 67,946,320 K205I probably damaging Het
Cmtr2 T A 8: 110,221,677 N206K probably damaging Het
Defb34 G A 8: 19,126,410 C39Y possibly damaging Het
Dennd3 T C 15: 73,556,447 S881P possibly damaging Het
Dglucy C T 12: 100,850,164 A325V probably benign Het
Dnah8 A G 17: 30,775,103 E3398G probably damaging Het
Dsc2 A T 18: 20,050,073 I96K probably damaging Het
Endov C T 11: 119,499,866 probably benign Het
Fam208a A G 14: 27,466,286 I896M probably benign Het
Fam208b G A 13: 3,574,752 P1733S probably damaging Het
Fer1l6 A T 15: 58,558,396 Q224L probably benign Het
Fmo2 T C 1: 162,877,044 N431S possibly damaging Het
Gata3 A C 2: 9,863,132 V337G probably damaging Het
Gm15448 A T 7: 3,824,612 F182Y unknown Het
Gtse1 G A 15: 85,862,231 V83M probably damaging Het
Hgd C A 16: 37,618,879 P224H possibly damaging Het
Kcnh6 T C 11: 106,017,548 V330A probably damaging Het
Kiz C G 2: 146,956,249 I631M probably damaging Het
Klhl18 T C 9: 110,436,050 D366G probably benign Het
Lrmda C T 14: 22,019,857 probably benign Het
Mc1r G T 8: 123,408,167 A220S probably damaging Het
Megf6 T A 4: 154,270,744 C1505* probably null Het
Mmp20 C T 9: 7,654,143 R355* probably null Het
Mmp28 T A 11: 83,444,832 Q280L probably damaging Het
Mppe1 C T 18: 67,237,417 A70T probably damaging Het
Mtif3 T G 5: 146,958,947 D110A possibly damaging Het
Mtss1l G A 8: 110,737,636 R361H possibly damaging Het
Mvp T C 7: 126,992,311 D542G probably damaging Het
Nlrp5 T C 7: 23,433,749 C940R probably damaging Het
Nmur2 C T 11: 56,026,982 V394I probably benign Het
Nwd2 A G 5: 63,808,281 H1736R probably benign Het
Olfr135 T C 17: 38,209,043 I266T probably benign Het
Purg A G 8: 33,416,633 Y317C possibly damaging Het
Ralgapa1 T A 12: 55,718,228 M880L probably benign Het
Sart3 A T 5: 113,754,379 probably null Het
Scaf4 G A 16: 90,229,852 Q1026* probably null Het
Slc26a1 A G 5: 108,671,869 L504P probably damaging Het
Slc35d1 C A 4: 103,208,133 V184L Het
Slc5a11 C T 7: 123,265,198 A339V probably damaging Het
Stab2 A T 10: 86,869,164 M1780K probably benign Het
Tas1r2 G A 4: 139,659,745 D172N probably benign Het
Thoc1 A T 18: 9,986,343 K358N probably damaging Het
Trim43a GATTTATTTATTTATTTATTTATTTATTTATTTATTTATT GATTTATTTATTTATTTATTTATTTATTTATTTATTTATTTATT 9: 88,582,989 probably benign Het
Ttll8 A C 15: 88,933,929 L181R probably damaging Het
Ubl4b G A 3: 107,554,468 Q159* probably null Het
Xrn1 A G 9: 96,011,679 H967R not run Het
Zeb2 T C 2: 44,994,532 D1049G probably damaging Het
Other mutations in Rap1gap
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00771:Rap1gap APN 4 137716524 missense probably damaging 0.98
IGL01810:Rap1gap APN 4 137716155 missense probably benign 0.07
IGL01944:Rap1gap APN 4 137725620 missense probably damaging 1.00
IGL02117:Rap1gap APN 4 137727044 missense probably damaging 0.98
IGL02271:Rap1gap APN 4 137718006 missense probably damaging 1.00
IGL02272:Rap1gap APN 4 137716566 missense probably damaging 1.00
IGL02590:Rap1gap APN 4 137720300 missense probably damaging 0.98
IGL02626:Rap1gap APN 4 137727053 missense probably benign 0.00
IGL03211:Rap1gap APN 4 137715846 critical splice donor site probably null
R0243:Rap1gap UTSW 4 137719351 missense probably damaging 0.99
R1239:Rap1gap UTSW 4 137717996 missense probably damaging 1.00
R1246:Rap1gap UTSW 4 137712094 missense possibly damaging 0.86
R2264:Rap1gap UTSW 4 137727723 missense probably benign
R2935:Rap1gap UTSW 4 137724731 missense probably benign 0.19
R3840:Rap1gap UTSW 4 137717447 missense probably damaging 1.00
R3841:Rap1gap UTSW 4 137717447 missense probably damaging 1.00
R4619:Rap1gap UTSW 4 137716111 missense probably damaging 1.00
R4821:Rap1gap UTSW 4 137712129 missense probably damaging 0.99
R4998:Rap1gap UTSW 4 137728284 missense possibly damaging 0.80
R5061:Rap1gap UTSW 4 137720433 critical splice donor site probably null
R5800:Rap1gap UTSW 4 137720377 missense probably benign 0.00
R6259:Rap1gap UTSW 4 137681757 critical splice donor site probably null
R7082:Rap1gap UTSW 4 137718936 missense probably damaging 1.00
R7098:Rap1gap UTSW 4 137716082 splice site probably null
R7234:Rap1gap UTSW 4 137728540 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TTAGCAGGTTGCCATCAGGG -3'
(R):5'- AGATAGCTGTGCTGGTTCCC -3'

Sequencing Primer
(F):5'- CAGGTTGCCATCAGGGTACAG -3'
(R):5'- GCTGGTTCCCCAATTCTCCAG -3'
Posted On2019-10-24