Incidental Mutation 'R0621:Slc6a5'
ID58668
Institutional Source Beutler Lab
Gene Symbol Slc6a5
Ensembl Gene ENSMUSG00000039728
Gene Namesolute carrier family 6 (neurotransmitter transporter, glycine), member 5
SynonymsGlyt2
MMRRC Submission 038810-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0621 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location49910146-49963856 bp(+) (GRCm38)
Type of Mutationsplice site (5 bp from exon)
DNA Base Change (assembly) G to A at 49917365 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000146917 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056442] [ENSMUST00000107605] [ENSMUST00000107605] [ENSMUST00000207753] [ENSMUST00000207753] [ENSMUST00000209172]
Predicted Effect probably null
Transcript: ENSMUST00000056442
SMART Domains Protein: ENSMUSP00000058699
Gene: ENSMUSG00000039728

DomainStartEndE-ValueType
Pfam:SNF 185 734 1.6e-218 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000107605
SMART Domains Protein: ENSMUSP00000103230
Gene: ENSMUSG00000039728

DomainStartEndE-ValueType
Pfam:SNF 185 734 1.6e-218 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000107605
SMART Domains Protein: ENSMUSP00000103230
Gene: ENSMUSG00000039728

DomainStartEndE-ValueType
Pfam:SNF 185 734 1.6e-218 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000207753
Predicted Effect probably null
Transcript: ENSMUST00000207753
Predicted Effect probably benign
Transcript: ENSMUST00000209172
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 99.0%
  • 10x: 97.8%
  • 20x: 96.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a sodium- and chloride-dependent glycine neurotransmitter transporter. This integral membrane glycoprotein is responsible for the clearance of extracellular glycine during glycine-mediated neurotransmission. This protein is found in glycinergic axons and maintains a high presynaptic pool of neurotransmitter at glycinergic synapses. Mutations in this gene cause hyperekplexia; a heterogenous neurological disorder characterized by exaggerated startle responses and neonatal apnea. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2016]
PHENOTYPE: Homozygous mutant mice appear normal at birth but develop a complex neuromotor phenotype involving tremors, rigidity, and an impaired righting ability. Mutant mice die approximately 2 weeks after birth. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abr T C 11: 76,509,072 D33G probably damaging Het
Adgre1 T A 17: 57,441,359 S520T probably damaging Het
Ankrd40 A G 11: 94,339,607 probably null Het
Aph1b A T 9: 66,779,334 I177K possibly damaging Het
Armc3 A T 2: 19,295,393 N579I probably damaging Het
Atxn7l1 T C 12: 33,326,100 V131A probably benign Het
C130073F10Rik A G 4: 101,890,795 Y61H probably damaging Het
C1s2 A T 6: 124,631,112 L214Q probably damaging Het
Caprin2 A T 6: 148,858,678 S425T possibly damaging Het
Cdc42ep4 G A 11: 113,728,696 R290C probably damaging Het
Cenpf T C 1: 189,672,628 T352A probably benign Het
Col6a4 A T 9: 106,066,791 F1161L probably damaging Het
Dctn2 T C 10: 127,277,940 probably null Het
Ddx24 T C 12: 103,425,558 probably benign Het
Dsg1c C A 18: 20,279,695 A591D possibly damaging Het
Efnb3 T C 11: 69,555,972 D304G probably damaging Het
Erbb3 T C 10: 128,586,225 Y50C probably benign Het
Eya3 T G 4: 132,694,802 D275E probably benign Het
Fam81a G T 9: 70,093,647 Q272K probably benign Het
Foxf1 T C 8: 121,085,180 V261A probably damaging Het
Gm9637 G A 14: 19,402,011 noncoding transcript Het
Gnb4 C T 3: 32,591,207 V112I probably benign Het
Gtf2h2 A T 13: 100,488,925 L61Q probably damaging Het
Hey2 T A 10: 30,834,386 I124F probably benign Het
Hoxb3 A T 11: 96,345,963 Y289F probably damaging Het
Kctd3 C T 1: 188,981,341 R399Q probably damaging Het
Kif26b C G 1: 178,915,653 P1105A probably benign Het
Klhl30 C T 1: 91,357,863 T369M probably damaging Het
Lipo2 C T 19: 33,730,939 G225D probably damaging Het
Macf1 T C 4: 123,380,534 K6350E probably damaging Het
Myh13 A C 11: 67,341,232 N446T probably damaging Het
Nos1ap T C 1: 170,318,581 D468G probably damaging Het
Olfr1250 C A 2: 89,657,115 E109* probably null Het
Olfr418 C T 1: 173,270,675 P167S possibly damaging Het
Olfr746 G A 14: 50,653,962 G242R possibly damaging Het
Pde3a T C 6: 141,249,999 L137P probably damaging Het
Ppm1f G A 16: 16,915,308 R233Q probably benign Het
Rtf2 C A 2: 172,466,296 A205E possibly damaging Het
Sh2d5 T C 4: 138,258,318 F359S probably benign Het
Siglec1 G A 2: 131,074,268 T1254M probably benign Het
Slc39a11 G A 11: 113,464,079 P108L probably benign Het
Snph C T 2: 151,593,722 V360M probably damaging Het
Snx29 A G 16: 11,405,787 probably null Het
Sos1 A G 17: 80,451,979 probably null Het
Spata5 C T 3: 37,432,029 T300I probably benign Het
St8sia6 T A 2: 13,657,282 N246I probably damaging Het
Thy1 T A 9: 44,046,733 F53I probably damaging Het
Tle3 T A 9: 61,410,105 Y421* probably null Het
Ttc21b C T 2: 66,226,011 R677Q probably benign Het
Vmn2r107 A T 17: 20,374,990 I602F probably benign Het
Wdr17 C A 8: 54,643,191 G1016C probably benign Het
Wdr62 T C 7: 30,254,061 E182G possibly damaging Het
Zfp597 A G 16: 3,866,364 I176T probably benign Het
Other mutations in Slc6a5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01373:Slc6a5 APN 7 49917733 missense probably benign 0.35
IGL01821:Slc6a5 APN 7 49914853 intron probably benign
R0084:Slc6a5 UTSW 7 49930013 missense probably benign 0.01
R0266:Slc6a5 UTSW 7 49938408 splice site probably benign
R0411:Slc6a5 UTSW 7 49911791 missense probably damaging 1.00
R1649:Slc6a5 UTSW 7 49936262 missense probably damaging 1.00
R1822:Slc6a5 UTSW 7 49956425 missense probably benign 0.00
R1889:Slc6a5 UTSW 7 49951434 missense probably benign 0.03
R2084:Slc6a5 UTSW 7 49948254 missense probably benign 0.14
R2098:Slc6a5 UTSW 7 49945567 missense probably damaging 1.00
R2365:Slc6a5 UTSW 7 49946536 missense possibly damaging 0.93
R2516:Slc6a5 UTSW 7 49956462 missense probably benign 0.00
R3622:Slc6a5 UTSW 7 49917623 missense probably benign 0.16
R3752:Slc6a5 UTSW 7 49936314 critical splice donor site probably null
R3848:Slc6a5 UTSW 7 49927558 splice site probably benign
R3917:Slc6a5 UTSW 7 49911869 missense probably damaging 1.00
R4617:Slc6a5 UTSW 7 49912020 missense probably benign 0.00
R4663:Slc6a5 UTSW 7 49938398 nonsense probably null
R4757:Slc6a5 UTSW 7 49959282 missense probably benign 0.15
R4916:Slc6a5 UTSW 7 49948256 missense probably benign 0.00
R5183:Slc6a5 UTSW 7 49936209 missense probably damaging 0.97
R5257:Slc6a5 UTSW 7 49929992 missense probably damaging 0.98
R5512:Slc6a5 UTSW 7 49941825 missense probably damaging 1.00
R5537:Slc6a5 UTSW 7 49959311 missense probably benign 0.03
R5558:Slc6a5 UTSW 7 49927573 missense probably benign
R5627:Slc6a5 UTSW 7 49911774 missense possibly damaging 0.85
R5655:Slc6a5 UTSW 7 49956470 missense probably benign
R5720:Slc6a5 UTSW 7 49956516 missense possibly damaging 0.86
R5736:Slc6a5 UTSW 7 49959354 missense probably benign 0.03
R5817:Slc6a5 UTSW 7 49956491 missense probably benign 0.00
R5879:Slc6a5 UTSW 7 49945512 missense probably damaging 1.00
R6033:Slc6a5 UTSW 7 49959351 missense probably benign 0.01
R6033:Slc6a5 UTSW 7 49959351 missense probably benign 0.01
R6072:Slc6a5 UTSW 7 49912195 missense probably damaging 1.00
R6157:Slc6a5 UTSW 7 49951502 missense probably benign 0.03
R6172:Slc6a5 UTSW 7 49948333 nonsense probably null
R6414:Slc6a5 UTSW 7 49910243 unclassified probably benign
R7348:Slc6a5 UTSW 7 49910167 unclassified probably benign
R7381:Slc6a5 UTSW 7 49930056 missense probably damaging 1.00
R7486:Slc6a5 UTSW 7 49917330 missense possibly damaging 0.81
R7624:Slc6a5 UTSW 7 49941866 missense probably benign 0.00
R7735:Slc6a5 UTSW 7 49948342 critical splice donor site probably null
R7760:Slc6a5 UTSW 7 49946617 missense probably benign 0.03
R8174:Slc6a5 UTSW 7 49948309 missense probably benign 0.39
R8219:Slc6a5 UTSW 7 49912163 missense probably benign
R8496:Slc6a5 UTSW 7 49936212 missense probably damaging 1.00
R8786:Slc6a5 UTSW 7 49912095 missense possibly damaging 0.48
Z1088:Slc6a5 UTSW 7 49911857 missense probably benign 0.40
Predicted Primers PCR Primer
(F):5'- AAGAAGGCCCTAAACTGCCCTGAG -3'
(R):5'- TGCCACAACCTGCAAAGGTGAAG -3'

Sequencing Primer
(F):5'- TGCCTACTGTAGAGCTAGGACAC -3'
(R):5'- GTATCATCCCAAAACCCCGTG -3'
Posted On2013-07-11