Incidental Mutation 'R7580:Cfap52'
ID586700
Institutional Source Beutler Lab
Gene Symbol Cfap52
Ensembl Gene ENSMUSG00000020904
Gene Namecilia and flagella associated protein 52
Synonyms4933417B11Rik, Wdr16, 1700019F09Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.850) question?
Stock #R7580 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location67924806-67965651 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 67946320 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Isoleucine at position 205 (K205I)
Ref Sequence ENSEMBL: ENSMUSP00000021287 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021287] [ENSMUST00000126766]
Predicted Effect probably damaging
Transcript: ENSMUST00000021287
AA Change: K205I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000021287
Gene: ENSMUSG00000020904
AA Change: K205I

DomainStartEndE-ValueType
WD40 53 97 3.71e-1 SMART
WD40 100 141 3.45e-3 SMART
WD40 149 186 1.03e1 SMART
low complexity region 262 273 N/A INTRINSIC
WD40 280 318 9.86e1 SMART
WD40 321 360 6.6e1 SMART
WD40 363 402 8.56e0 SMART
WD40 405 445 2.27e-3 SMART
WD40 450 489 3.14e-6 SMART
WD40 492 530 9.21e0 SMART
WD40 533 573 6.19e-5 SMART
WD40 576 615 2.15e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000126766
AA Change: K205I

PolyPhen 2 Score 0.386 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000116496
Gene: ENSMUSG00000020904
AA Change: K205I

DomainStartEndE-ValueType
WD40 53 97 3.71e-1 SMART
WD40 100 141 3.45e-3 SMART
WD40 149 186 1.03e1 SMART
Blast:WD40 190 233 4e-12 BLAST
low complexity region 262 273 N/A INTRINSIC
WD40 280 318 9.86e1 SMART
Blast:WD40 321 342 1e-6 BLAST
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (54/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] WD repeat-containing proteins, such as WDR16, play crucial roles in a wide range of physiologic functions, including signal transduction, RNA processing, remodeling the cytoskeleton, regulation of vesicular traffic, and cell division (Silva et al., 2005 [PubMed 15967112]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930486L24Rik T A 13: 60,845,226 Y213F probably damaging Het
Adamdec1 A G 14: 68,565,531 S462P probably benign Het
Adamtsl1 T A 4: 86,054,064 C3S possibly damaging Het
Bag1 C T 4: 40,947,836 E123K probably benign Het
Brip1 A G 11: 86,157,601 L305P probably damaging Het
Cage1 T A 13: 38,022,724 I382F possibly damaging Het
Cmtr2 T A 8: 110,221,677 N206K probably damaging Het
Defb34 G A 8: 19,126,410 C39Y possibly damaging Het
Dennd3 T C 15: 73,556,447 S881P possibly damaging Het
Dglucy C T 12: 100,850,164 A325V probably benign Het
Dnah8 A G 17: 30,775,103 E3398G probably damaging Het
Dsc2 A T 18: 20,050,073 I96K probably damaging Het
Endov C T 11: 119,499,866 probably benign Het
Fam208a A G 14: 27,466,286 I896M probably benign Het
Fam208b G A 13: 3,574,752 P1733S probably damaging Het
Fer1l6 A T 15: 58,558,396 Q224L probably benign Het
Fmo2 T C 1: 162,877,044 N431S possibly damaging Het
Gata3 A C 2: 9,863,132 V337G probably damaging Het
Gm15448 A T 7: 3,824,612 F182Y unknown Het
Gtse1 G A 15: 85,862,231 V83M probably damaging Het
Hgd C A 16: 37,618,879 P224H possibly damaging Het
Kcnh6 T C 11: 106,017,548 V330A probably damaging Het
Kiz C G 2: 146,956,249 I631M probably damaging Het
Klhl18 T C 9: 110,436,050 D366G probably benign Het
Lrmda C T 14: 22,019,857 probably benign Het
Mc1r G T 8: 123,408,167 A220S probably damaging Het
Megf6 T A 4: 154,270,744 C1505* probably null Het
Mmp20 C T 9: 7,654,143 R355* probably null Het
Mmp28 T A 11: 83,444,832 Q280L probably damaging Het
Mppe1 C T 18: 67,237,417 A70T probably damaging Het
Mtif3 T G 5: 146,958,947 D110A possibly damaging Het
Mtss1l G A 8: 110,737,636 R361H possibly damaging Het
Mvp T C 7: 126,992,311 D542G probably damaging Het
Nlrp5 T C 7: 23,433,749 C940R probably damaging Het
Nmur2 C T 11: 56,026,982 V394I probably benign Het
Nwd2 A G 5: 63,808,281 H1736R probably benign Het
Olfr135 T C 17: 38,209,043 I266T probably benign Het
Purg A G 8: 33,416,633 Y317C possibly damaging Het
Ralgapa1 T A 12: 55,718,228 M880L probably benign Het
Rap1gap T C 4: 137,719,982 F413L possibly damaging Het
Sart3 A T 5: 113,754,379 probably null Het
Scaf4 G A 16: 90,229,852 Q1026* probably null Het
Slc26a1 A G 5: 108,671,869 L504P probably damaging Het
Slc35d1 C A 4: 103,208,133 V184L Het
Slc5a11 C T 7: 123,265,198 A339V probably damaging Het
Stab2 A T 10: 86,869,164 M1780K probably benign Het
Tas1r2 G A 4: 139,659,745 D172N probably benign Het
Thoc1 A T 18: 9,986,343 K358N probably damaging Het
Trim43a GATTTATTTATTTATTTATTTATTTATTTATTTATTTATT GATTTATTTATTTATTTATTTATTTATTTATTTATTTATTTATT 9: 88,582,989 probably benign Het
Ttll8 A C 15: 88,933,929 L181R probably damaging Het
Ubl4b G A 3: 107,554,468 Q159* probably null Het
Xrn1 A G 9: 96,011,679 H967R not run Het
Zeb2 T C 2: 44,994,532 D1049G probably damaging Het
Other mutations in Cfap52
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01758:Cfap52 APN 11 67953580 missense possibly damaging 0.67
IGL02034:Cfap52 APN 11 67946292 splice site probably null
IGL02530:Cfap52 APN 11 67954181 splice site probably benign
IGL02558:Cfap52 APN 11 67954138 missense probably benign 0.31
IGL02873:Cfap52 APN 11 67931782 missense probably damaging 1.00
IGL02887:Cfap52 APN 11 67953515 missense probably damaging 1.00
IGL02956:Cfap52 APN 11 67954075 missense probably benign
IGL03068:Cfap52 APN 11 67935856 missense probably benign 0.11
IGL03216:Cfap52 APN 11 67954106 missense possibly damaging 0.81
IGL03287:Cfap52 APN 11 67935976 unclassified probably benign
IGL03370:Cfap52 APN 11 67939055 missense probably damaging 0.98
chewbacca UTSW 11 67925125 missense possibly damaging 0.95
R0103:Cfap52 UTSW 11 67925125 missense possibly damaging 0.95
R0103:Cfap52 UTSW 11 67925125 missense possibly damaging 0.95
R0244:Cfap52 UTSW 11 67926382 missense possibly damaging 0.90
R0306:Cfap52 UTSW 11 67954070 missense probably benign
R0364:Cfap52 UTSW 11 67953610 missense possibly damaging 0.80
R0440:Cfap52 UTSW 11 67954088 missense probably benign
R0565:Cfap52 UTSW 11 67949599 missense probably benign 0.00
R1068:Cfap52 UTSW 11 67939004 missense probably benign 0.10
R1082:Cfap52 UTSW 11 67925172 missense probably damaging 0.99
R1509:Cfap52 UTSW 11 67938993 missense probably benign 0.00
R1894:Cfap52 UTSW 11 67953619 critical splice acceptor site probably null
R2994:Cfap52 UTSW 11 67939791 missense probably benign
R3954:Cfap52 UTSW 11 67930865 missense probably benign
R4611:Cfap52 UTSW 11 67926421 missense probably damaging 0.99
R4922:Cfap52 UTSW 11 67931722 critical splice donor site probably null
R5624:Cfap52 UTSW 11 67927358 missense possibly damaging 0.92
R5762:Cfap52 UTSW 11 67954121 missense possibly damaging 0.71
R5970:Cfap52 UTSW 11 67930744 missense probably damaging 1.00
R6037:Cfap52 UTSW 11 67946300 missense probably benign 0.00
R6037:Cfap52 UTSW 11 67946300 missense probably benign 0.00
R6260:Cfap52 UTSW 11 67938954 missense possibly damaging 0.85
R7401:Cfap52 UTSW 11 67949633 missense probably benign 0.02
R7831:Cfap52 UTSW 11 67935956 missense possibly damaging 0.89
R7966:Cfap52 UTSW 11 67953745 splice site probably null
R8303:Cfap52 UTSW 11 67939795 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ATGGGACCTCTTAGCGCTTG -3'
(R):5'- CTGTCAGCTTCTCCTTCAAGAG -3'

Sequencing Primer
(F):5'- GCTGTGTGCTCCCTCTGAG -3'
(R):5'- TCCTTCAAGAGGGGGTGAG -3'
Posted On2019-10-24