Incidental Mutation 'R7580:Fam208a'
ID586710
Institutional Source Beutler Lab
Gene Symbol Fam208a
Ensembl Gene ENSMUSG00000040651
Gene Namefamily with sequence similarity 208, member A
SynonymsD14Abb1e, 4933409E02Rik
MMRRC Submission
Accession Numbers

Ensembl: ENSMUST00000059031; MGI: 1921694

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7580 (G1)
Quality Score225.009
Status Validated
Chromosome14
Chromosomal Location27428834-27483555 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 27466286 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Methionine at position 896 (I896M)
Ref Sequence ENSEMBL: ENSMUSP00000022450 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022450]
Predicted Effect probably benign
Transcript: ENSMUST00000022450
AA Change: I896M

PolyPhen 2 Score 0.288 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000022450
Gene: ENSMUSG00000040651
AA Change: I896M

DomainStartEndE-ValueType
low complexity region 20 27 N/A INTRINSIC
low complexity region 42 61 N/A INTRINSIC
low complexity region 74 88 N/A INTRINSIC
Pfam:DUF3715 153 314 1.5e-55 PFAM
low complexity region 442 457 N/A INTRINSIC
low complexity region 1087 1102 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (54/54)
MGI Phenotype PHENOTYPE: Mice homozygous for ENU mutations are not viable past gastrulation. [provided by MGI curators]
Allele List at MGI

All alleles(26) : Gene trapped(26)

Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930486L24Rik T A 13: 60,845,226 Y213F probably damaging Het
Adamdec1 A G 14: 68,565,531 S462P probably benign Het
Adamtsl1 T A 4: 86,054,064 C3S possibly damaging Het
Bag1 C T 4: 40,947,836 E123K probably benign Het
Brip1 A G 11: 86,157,601 L305P probably damaging Het
Cage1 T A 13: 38,022,724 I382F possibly damaging Het
Cfap52 T A 11: 67,946,320 K205I probably damaging Het
Cmtr2 T A 8: 110,221,677 N206K probably damaging Het
Defb34 G A 8: 19,126,410 C39Y possibly damaging Het
Dennd3 T C 15: 73,556,447 S881P possibly damaging Het
Dglucy C T 12: 100,850,164 A325V probably benign Het
Dnah8 A G 17: 30,775,103 E3398G probably damaging Het
Dsc2 A T 18: 20,050,073 I96K probably damaging Het
Endov C T 11: 119,499,866 probably benign Het
Fam208b G A 13: 3,574,752 P1733S probably damaging Het
Fer1l6 A T 15: 58,558,396 Q224L probably benign Het
Fmo2 T C 1: 162,877,044 N431S possibly damaging Het
Gata3 A C 2: 9,863,132 V337G probably damaging Het
Gm15448 A T 7: 3,824,612 F182Y unknown Het
Gtse1 G A 15: 85,862,231 V83M probably damaging Het
Hgd C A 16: 37,618,879 P224H possibly damaging Het
Kcnh6 T C 11: 106,017,548 V330A probably damaging Het
Kiz C G 2: 146,956,249 I631M probably damaging Het
Klhl18 T C 9: 110,436,050 D366G probably benign Het
Lrmda C T 14: 22,019,857 probably benign Het
Mc1r G T 8: 123,408,167 A220S probably damaging Het
Megf6 T A 4: 154,270,744 C1505* probably null Het
Mmp20 C T 9: 7,654,143 R355* probably null Het
Mmp28 T A 11: 83,444,832 Q280L probably damaging Het
Mppe1 C T 18: 67,237,417 A70T probably damaging Het
Mtif3 T G 5: 146,958,947 D110A possibly damaging Het
Mtss1l G A 8: 110,737,636 R361H possibly damaging Het
Mvp T C 7: 126,992,311 D542G probably damaging Het
Nlrp5 T C 7: 23,433,749 C940R probably damaging Het
Nmur2 C T 11: 56,026,982 V394I probably benign Het
Nwd2 A G 5: 63,808,281 H1736R probably benign Het
Olfr135 T C 17: 38,209,043 I266T probably benign Het
Purg A G 8: 33,416,633 Y317C possibly damaging Het
Ralgapa1 T A 12: 55,718,228 M880L probably benign Het
Rap1gap T C 4: 137,719,982 F413L possibly damaging Het
Sart3 A T 5: 113,754,379 probably null Het
Scaf4 G A 16: 90,229,852 Q1026* probably null Het
Slc26a1 A G 5: 108,671,869 L504P probably damaging Het
Slc35d1 C A 4: 103,208,133 V184L Het
Slc5a11 C T 7: 123,265,198 A339V probably damaging Het
Stab2 A T 10: 86,869,164 M1780K probably benign Het
Tas1r2 G A 4: 139,659,745 D172N probably benign Het
Thoc1 A T 18: 9,986,343 K358N probably damaging Het
Trim43a GATTTATTTATTTATTTATTTATTTATTTATTTATTTATT GATTTATTTATTTATTTATTTATTTATTTATTTATTTATTTATT 9: 88,582,989 probably benign Het
Ttll8 A C 15: 88,933,929 L181R probably damaging Het
Ubl4b G A 3: 107,554,468 Q159* probably null Het
Xrn1 A G 9: 96,011,679 H967R not run Het
Zeb2 T C 2: 44,994,532 D1049G probably damaging Het
Other mutations in Fam208a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00093:Fam208a APN 14 27448206 missense probably damaging 1.00
IGL00467:Fam208a APN 14 27448164 missense probably benign 0.02
IGL01071:Fam208a APN 14 27442622 critical splice donor site probably null
IGL01351:Fam208a APN 14 27464301 missense probably benign 0.02
IGL01375:Fam208a APN 14 27440163 missense probably damaging 1.00
IGL01509:Fam208a APN 14 27459774 splice site probably benign
IGL02342:Fam208a APN 14 27476667 missense possibly damaging 0.83
IGL03105:Fam208a APN 14 27442552 missense probably damaging 0.98
IGL03131:Fam208a APN 14 27461179 nonsense probably null
IGL03248:Fam208a APN 14 27476692 missense probably damaging 1.00
IGL03383:Fam208a APN 14 27441961 missense possibly damaging 0.93
balsam UTSW 14 27461150 missense probably benign 0.01
santa_rosa UTSW 14 27476701 splice site probably null
D4043:Fam208a UTSW 14 27471992 missense probably benign 0.07
R0147:Fam208a UTSW 14 27471768 missense probably benign 0.23
R0512:Fam208a UTSW 14 27446406 missense probably damaging 1.00
R0589:Fam208a UTSW 14 27461150 missense probably benign 0.01
R0609:Fam208a UTSW 14 27461750 missense probably benign 0.09
R0798:Fam208a UTSW 14 27476636 missense probably damaging 1.00
R1107:Fam208a UTSW 14 27479723 nonsense probably null
R1205:Fam208a UTSW 14 27461318 missense probably damaging 1.00
R1376:Fam208a UTSW 14 27429381 missense probably benign 0.00
R1376:Fam208a UTSW 14 27429381 missense probably benign 0.00
R1441:Fam208a UTSW 14 27464260 nonsense probably null
R1493:Fam208a UTSW 14 27449969 missense probably damaging 1.00
R1527:Fam208a UTSW 14 27480093 critical splice donor site probably null
R1729:Fam208a UTSW 14 27479633 missense probably damaging 1.00
R1752:Fam208a UTSW 14 27471928 nonsense probably null
R1960:Fam208a UTSW 14 27438664 missense probably damaging 1.00
R1960:Fam208a UTSW 14 27479789 missense possibly damaging 0.95
R1965:Fam208a UTSW 14 27442554 missense probably damaging 1.00
R2074:Fam208a UTSW 14 27461213 missense probably benign 0.03
R2107:Fam208a UTSW 14 27461787 critical splice donor site probably null
R2130:Fam208a UTSW 14 27446388 missense probably damaging 1.00
R2130:Fam208a UTSW 14 27476614 missense possibly damaging 0.74
R2131:Fam208a UTSW 14 27476614 missense possibly damaging 0.74
R2133:Fam208a UTSW 14 27476614 missense possibly damaging 0.74
R2140:Fam208a UTSW 14 27480035 missense probably damaging 1.00
R2184:Fam208a UTSW 14 27466184 missense possibly damaging 0.83
R2279:Fam208a UTSW 14 27442495 missense probably damaging 1.00
R3979:Fam208a UTSW 14 27477130 missense possibly damaging 0.95
R4113:Fam208a UTSW 14 27459961 nonsense probably null
R4434:Fam208a UTSW 14 27449861 critical splice donor site probably null
R4562:Fam208a UTSW 14 27466308 missense possibly damaging 0.67
R4568:Fam208a UTSW 14 27476701 splice site probably null
R4754:Fam208a UTSW 14 27461095 missense probably benign
R4980:Fam208a UTSW 14 27461425 missense probably benign 0.39
R4993:Fam208a UTSW 14 27429114 missense possibly damaging 0.88
R5200:Fam208a UTSW 14 27429226 missense probably benign 0.41
R5316:Fam208a UTSW 14 27472035 missense possibly damaging 0.52
R5599:Fam208a UTSW 14 27479929 missense probably benign 0.01
R5678:Fam208a UTSW 14 27429123 small insertion probably benign
R5680:Fam208a UTSW 14 27429123 small insertion probably benign
R5887:Fam208a UTSW 14 27466297 nonsense probably null
R6181:Fam208a UTSW 14 27472278 missense probably benign 0.01
R6556:Fam208a UTSW 14 27429258 missense probably benign
R6603:Fam208a UTSW 14 27446386 missense probably damaging 1.00
R6829:Fam208a UTSW 14 27442481 missense possibly damaging 0.90
R6864:Fam208a UTSW 14 27461158 missense probably damaging 0.96
R6919:Fam208a UTSW 14 27449801 nonsense probably null
R7046:Fam208a UTSW 14 27472435 missense probably damaging 1.00
R7057:Fam208a UTSW 14 27461651 missense probably damaging 0.97
R7064:Fam208a UTSW 14 27472331 missense probably benign 0.09
R7290:Fam208a UTSW 14 27438653 missense probably damaging 1.00
R7303:Fam208a UTSW 14 27471852 missense probably damaging 1.00
R7439:Fam208a UTSW 14 27471645 missense probably damaging 1.00
R7524:Fam208a UTSW 14 27466203 missense probably damaging 0.99
R7726:Fam208a UTSW 14 27447497 missense probably damaging 0.99
R7771:Fam208a UTSW 14 27467559 missense probably damaging 1.00
R7782:Fam208a UTSW 14 27471944 missense probably benign 0.07
R7795:Fam208a UTSW 14 27481383 missense
R7835:Fam208a UTSW 14 27476643 missense probably damaging 1.00
R7954:Fam208a UTSW 14 27447524 critical splice donor site probably null
R7981:Fam208a UTSW 14 27446416 missense possibly damaging 0.49
R8101:Fam208a UTSW 14 27442481 missense possibly damaging 0.90
R8160:Fam208a UTSW 14 27449956 missense probably damaging 1.00
R8307:Fam208a UTSW 14 27471665 missense probably damaging 1.00
X0002:Fam208a UTSW 14 27472106 missense possibly damaging 0.90
Z1176:Fam208a UTSW 14 27429208 missense probably damaging 0.97
Z1176:Fam208a UTSW 14 27477148 missense probably damaging 1.00
Z1177:Fam208a UTSW 14 27448250 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGAGGAAGTAGTATGGTCTCGAC -3'
(R):5'- TAGACCCCTTTGCAGATACTTGC -3'

Sequencing Primer
(F):5'- TTGAAGGGTGCAGTCTCT -3'
(R):5'- GACCCCTTTGCAGATACTTGCTTATG -3'
Posted On2019-10-24