Incidental Mutation 'R7580:Adamdec1'
ID586711
Institutional Source Beutler Lab
Gene Symbol Adamdec1
Ensembl Gene ENSMUSG00000022057
Gene NameADAM-like, decysin 1
Synonyms2210414L24Rik, Dcsn
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.074) question?
Stock #R7580 (G1)
Quality Score225.009
Status Validated
Chromosome14
Chromosomal Location68563380-68582095 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 68565531 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 462 (S462P)
Ref Sequence ENSEMBL: ENSMUSP00000022641 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022641]
Predicted Effect probably benign
Transcript: ENSMUST00000022641
AA Change: S462P

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000022641
Gene: ENSMUSG00000022057
AA Change: S462P

DomainStartEndE-ValueType
signal peptide 1 33 N/A INTRINSIC
Pfam:Pep_M12B_propep 37 175 3.9e-29 PFAM
Pfam:Reprolysin_5 215 389 9.8e-17 PFAM
Pfam:Reprolysin_4 216 407 7.3e-12 PFAM
Pfam:Reprolysin 217 411 1.5e-57 PFAM
Pfam:Reprolysin_3 242 360 1e-11 PFAM
DISIN 427 465 1.12e-3 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (54/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This encoded protein is thought to be a secreted protein belonging to the disintegrin metalloproteinase family. Its expression is upregulated during dendritic cells maturation. This protein may play an important role in dendritic cell function and their interactions with germinal center T cells. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930486L24Rik T A 13: 60,845,226 Y213F probably damaging Het
Adamtsl1 T A 4: 86,054,064 C3S possibly damaging Het
Bag1 C T 4: 40,947,836 E123K probably benign Het
Brip1 A G 11: 86,157,601 L305P probably damaging Het
Cage1 T A 13: 38,022,724 I382F possibly damaging Het
Cfap52 T A 11: 67,946,320 K205I probably damaging Het
Cmtr2 T A 8: 110,221,677 N206K probably damaging Het
Defb34 G A 8: 19,126,410 C39Y possibly damaging Het
Dennd3 T C 15: 73,556,447 S881P possibly damaging Het
Dglucy C T 12: 100,850,164 A325V probably benign Het
Dnah8 A G 17: 30,775,103 E3398G probably damaging Het
Dsc2 A T 18: 20,050,073 I96K probably damaging Het
Endov C T 11: 119,499,866 probably benign Het
Fam208a A G 14: 27,466,286 I896M probably benign Het
Fam208b G A 13: 3,574,752 P1733S probably damaging Het
Fer1l6 A T 15: 58,558,396 Q224L probably benign Het
Fmo2 T C 1: 162,877,044 N431S possibly damaging Het
Gata3 A C 2: 9,863,132 V337G probably damaging Het
Gm15448 A T 7: 3,824,612 F182Y unknown Het
Gtse1 G A 15: 85,862,231 V83M probably damaging Het
Hgd C A 16: 37,618,879 P224H possibly damaging Het
Kcnh6 T C 11: 106,017,548 V330A probably damaging Het
Kiz C G 2: 146,956,249 I631M probably damaging Het
Klhl18 T C 9: 110,436,050 D366G probably benign Het
Lrmda C T 14: 22,019,857 probably benign Het
Mc1r G T 8: 123,408,167 A220S probably damaging Het
Megf6 T A 4: 154,270,744 C1505* probably null Het
Mmp20 C T 9: 7,654,143 R355* probably null Het
Mmp28 T A 11: 83,444,832 Q280L probably damaging Het
Mppe1 C T 18: 67,237,417 A70T probably damaging Het
Mtif3 T G 5: 146,958,947 D110A possibly damaging Het
Mtss1l G A 8: 110,737,636 R361H possibly damaging Het
Mvp T C 7: 126,992,311 D542G probably damaging Het
Nlrp5 T C 7: 23,433,749 C940R probably damaging Het
Nmur2 C T 11: 56,026,982 V394I probably benign Het
Nwd2 A G 5: 63,808,281 H1736R probably benign Het
Olfr135 T C 17: 38,209,043 I266T probably benign Het
Purg A G 8: 33,416,633 Y317C possibly damaging Het
Ralgapa1 T A 12: 55,718,228 M880L probably benign Het
Rap1gap T C 4: 137,719,982 F413L possibly damaging Het
Sart3 A T 5: 113,754,379 probably null Het
Scaf4 G A 16: 90,229,852 Q1026* probably null Het
Slc26a1 A G 5: 108,671,869 L504P probably damaging Het
Slc35d1 C A 4: 103,208,133 V184L Het
Slc5a11 C T 7: 123,265,198 A339V probably damaging Het
Stab2 A T 10: 86,869,164 M1780K probably benign Het
Tas1r2 G A 4: 139,659,745 D172N probably benign Het
Thoc1 A T 18: 9,986,343 K358N probably damaging Het
Trim43a GATTTATTTATTTATTTATTTATTTATTTATTTATTTATT GATTTATTTATTTATTTATTTATTTATTTATTTATTTATTTATT 9: 88,582,989 probably benign Het
Ttll8 A C 15: 88,933,929 L181R probably damaging Het
Ubl4b G A 3: 107,554,468 Q159* probably null Het
Xrn1 A G 9: 96,011,679 H967R not run Het
Zeb2 T C 2: 44,994,532 D1049G probably damaging Het
Other mutations in Adamdec1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01691:Adamdec1 APN 14 68573107 missense probably damaging 1.00
IGL02026:Adamdec1 APN 14 68571802 missense possibly damaging 0.81
IGL02068:Adamdec1 APN 14 68577109 missense probably benign 0.21
IGL02416:Adamdec1 APN 14 68572833 missense probably null 0.99
IGL02739:Adamdec1 APN 14 68570156 nonsense probably null
IGL03078:Adamdec1 APN 14 68568850 missense possibly damaging 0.53
IGL03115:Adamdec1 APN 14 68571353 missense probably damaging 1.00
R0201:Adamdec1 UTSW 14 68581957 critical splice donor site probably null
R0243:Adamdec1 UTSW 14 68581958 critical splice donor site probably null
R0244:Adamdec1 UTSW 14 68568723 nonsense probably null
R0416:Adamdec1 UTSW 14 68568712 missense possibly damaging 0.79
R1373:Adamdec1 UTSW 14 68570951 missense probably damaging 1.00
R1856:Adamdec1 UTSW 14 68570948 missense probably damaging 1.00
R2570:Adamdec1 UTSW 14 68579208 missense probably damaging 0.98
R3684:Adamdec1 UTSW 14 68581998 missense probably benign 0.04
R3755:Adamdec1 UTSW 14 68577138 missense probably damaging 1.00
R4450:Adamdec1 UTSW 14 68573119 missense probably benign 0.00
R4661:Adamdec1 UTSW 14 68570113 missense probably damaging 1.00
R4672:Adamdec1 UTSW 14 68577904 nonsense probably null
R4673:Adamdec1 UTSW 14 68577904 nonsense probably null
R4902:Adamdec1 UTSW 14 68571766 missense probably damaging 0.99
R5017:Adamdec1 UTSW 14 68573245 missense probably benign 0.01
R5018:Adamdec1 UTSW 14 68571779 missense probably damaging 1.00
R5141:Adamdec1 UTSW 14 68573128 missense probably benign 0.00
R5329:Adamdec1 UTSW 14 68570163 missense probably damaging 1.00
R5395:Adamdec1 UTSW 14 68570903 missense probably benign 0.04
R5864:Adamdec1 UTSW 14 68570102 missense probably damaging 1.00
R6032:Adamdec1 UTSW 14 68579184 missense probably damaging 1.00
R6032:Adamdec1 UTSW 14 68579184 missense probably damaging 1.00
R6114:Adamdec1 UTSW 14 68571803 missense probably benign 0.00
R6633:Adamdec1 UTSW 14 68573152 missense probably benign 0.03
R7243:Adamdec1 UTSW 14 68571754 missense probably benign 0.06
X0025:Adamdec1 UTSW 14 68570158 missense probably damaging 1.00
X0050:Adamdec1 UTSW 14 68570158 missense probably damaging 1.00
X0062:Adamdec1 UTSW 14 68573252 missense probably benign 0.12
Z1177:Adamdec1 UTSW 14 68580643 missense probably benign
Predicted Primers PCR Primer
(F):5'- TTTTAGCACAAGTTCCAGGAAC -3'
(R):5'- GGATGGCTCCACACTTAGTTATATA -3'

Sequencing Primer
(F):5'- TCAAGCACATAGCCTCAG -3'
(R):5'- CATGTGGAGCAAACTTGTCTC -3'
Posted On2019-10-24