Incidental Mutation 'R7580:Mppe1'
ID586722
Institutional Source Beutler Lab
Gene Symbol Mppe1
Ensembl Gene ENSMUSG00000062526
Gene Namemetallophosphoesterase 1
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.101) question?
Stock #R7580 (G1)
Quality Score225.009
Status Validated
Chromosome18
Chromosomal Location67225530-67245830 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 67237417 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Threonine at position 70 (A70T)
Ref Sequence ENSEMBL: ENSMUSP00000072808 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073054]
Predicted Effect probably damaging
Transcript: ENSMUST00000073054
AA Change: A70T

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000072808
Gene: ENSMUSG00000062526
AA Change: A70T

DomainStartEndE-ValueType
transmembrane domain 21 43 N/A INTRINSIC
Pfam:Metallophos 68 308 3.3e-13 PFAM
transmembrane domain 358 380 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (54/54)
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930486L24Rik T A 13: 60,845,226 Y213F probably damaging Het
Adamdec1 A G 14: 68,565,531 S462P probably benign Het
Adamtsl1 T A 4: 86,054,064 C3S possibly damaging Het
Bag1 C T 4: 40,947,836 E123K probably benign Het
Brip1 A G 11: 86,157,601 L305P probably damaging Het
Cage1 T A 13: 38,022,724 I382F possibly damaging Het
Cfap52 T A 11: 67,946,320 K205I probably damaging Het
Cmtr2 T A 8: 110,221,677 N206K probably damaging Het
Defb34 G A 8: 19,126,410 C39Y possibly damaging Het
Dennd3 T C 15: 73,556,447 S881P possibly damaging Het
Dglucy C T 12: 100,850,164 A325V probably benign Het
Dnah8 A G 17: 30,775,103 E3398G probably damaging Het
Dsc2 A T 18: 20,050,073 I96K probably damaging Het
Endov C T 11: 119,499,866 probably benign Het
Fam208a A G 14: 27,466,286 I896M probably benign Het
Fam208b G A 13: 3,574,752 P1733S probably damaging Het
Fer1l6 A T 15: 58,558,396 Q224L probably benign Het
Fmo2 T C 1: 162,877,044 N431S possibly damaging Het
Gata3 A C 2: 9,863,132 V337G probably damaging Het
Gm15448 A T 7: 3,824,612 F182Y unknown Het
Gtse1 G A 15: 85,862,231 V83M probably damaging Het
Hgd C A 16: 37,618,879 P224H possibly damaging Het
Kcnh6 T C 11: 106,017,548 V330A probably damaging Het
Kiz C G 2: 146,956,249 I631M probably damaging Het
Klhl18 T C 9: 110,436,050 D366G probably benign Het
Lrmda C T 14: 22,019,857 probably benign Het
Mc1r G T 8: 123,408,167 A220S probably damaging Het
Megf6 T A 4: 154,270,744 C1505* probably null Het
Mmp20 C T 9: 7,654,143 R355* probably null Het
Mmp28 T A 11: 83,444,832 Q280L probably damaging Het
Mtif3 T G 5: 146,958,947 D110A possibly damaging Het
Mtss1l G A 8: 110,737,636 R361H possibly damaging Het
Mvp T C 7: 126,992,311 D542G probably damaging Het
Nlrp5 T C 7: 23,433,749 C940R probably damaging Het
Nmur2 C T 11: 56,026,982 V394I probably benign Het
Nwd2 A G 5: 63,808,281 H1736R probably benign Het
Olfr135 T C 17: 38,209,043 I266T probably benign Het
Purg A G 8: 33,416,633 Y317C possibly damaging Het
Ralgapa1 T A 12: 55,718,228 M880L probably benign Het
Rap1gap T C 4: 137,719,982 F413L possibly damaging Het
Sart3 A T 5: 113,754,379 probably null Het
Scaf4 G A 16: 90,229,852 Q1026* probably null Het
Slc26a1 A G 5: 108,671,869 L504P probably damaging Het
Slc35d1 C A 4: 103,208,133 V184L Het
Slc5a11 C T 7: 123,265,198 A339V probably damaging Het
Stab2 A T 10: 86,869,164 M1780K probably benign Het
Tas1r2 G A 4: 139,659,745 D172N probably benign Het
Thoc1 A T 18: 9,986,343 K358N probably damaging Het
Trim43a GATTTATTTATTTATTTATTTATTTATTTATTTATTTATT GATTTATTTATTTATTTATTTATTTATTTATTTATTTATTTATT 9: 88,582,989 probably benign Het
Ttll8 A C 15: 88,933,929 L181R probably damaging Het
Ubl4b G A 3: 107,554,468 Q159* probably null Het
Xrn1 A G 9: 96,011,679 H967R not run Het
Zeb2 T C 2: 44,994,532 D1049G probably damaging Het
Other mutations in Mppe1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01129:Mppe1 APN 18 67237444 nonsense probably null
IGL03028:Mppe1 APN 18 67227684 missense probably damaging 1.00
R0087:Mppe1 UTSW 18 67225704 makesense probably null
R0538:Mppe1 UTSW 18 67237477 missense probably damaging 1.00
R0552:Mppe1 UTSW 18 67237348 critical splice donor site probably null
R1170:Mppe1 UTSW 18 67227706 missense probably damaging 1.00
R1970:Mppe1 UTSW 18 67229772 missense probably benign 0.07
R2229:Mppe1 UTSW 18 67228011 critical splice donor site probably null
R3874:Mppe1 UTSW 18 67225886 critical splice acceptor site probably null
R4194:Mppe1 UTSW 18 67228068 missense probably benign 0.27
R4775:Mppe1 UTSW 18 67226859 missense possibly damaging 0.96
R4940:Mppe1 UTSW 18 67228024 missense probably damaging 1.00
R4974:Mppe1 UTSW 18 67228062 missense probably benign
R4979:Mppe1 UTSW 18 67229702 missense probably damaging 1.00
R5768:Mppe1 UTSW 18 67225818 missense possibly damaging 0.87
R5784:Mppe1 UTSW 18 67228027 missense probably benign 0.12
R5895:Mppe1 UTSW 18 67225763 missense probably benign 0.00
R6547:Mppe1 UTSW 18 67228988 missense probably benign
R7161:Mppe1 UTSW 18 67229771 missense probably benign 0.10
R7699:Mppe1 UTSW 18 67225704 makesense probably null
R7700:Mppe1 UTSW 18 67225704 makesense probably null
R7908:Mppe1 UTSW 18 67228984 missense probably benign 0.01
R8399:Mppe1 UTSW 18 67225875 missense probably benign 0.17
Predicted Primers PCR Primer
(F):5'- CTCGCACACGACTTTAGAAGG -3'
(R):5'- GGTTCTCTTCTGCTGGCAAC -3'

Sequencing Primer
(F):5'- CACACGACTTTAGAAGGAAATAGGTC -3'
(R):5'- AAGACAGAACTTCCATCCGTTGAGG -3'
Posted On2019-10-24