Incidental Mutation 'R7581:Large2'
ID 586724
Institutional Source Beutler Lab
Gene Symbol Large2
Ensembl Gene ENSMUSG00000040434
Gene Name LARGE xylosyl- and glucuronyltransferase 2
Synonyms 5730485C17Rik, Gyltl1b
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R7581 (G1)
Quality Score 225.009
Status Validated
Chromosome 2
Chromosomal Location 92365046-92374869 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 92370193 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 89 (S89P)
Ref Sequence ENSEMBL: ENSMUSP00000064128 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068586] [ENSMUST00000090582] [ENSMUST00000111284] [ENSMUST00000148352] [ENSMUST00000176289] [ENSMUST00000176339] [ENSMUST00000176774] [ENSMUST00000176810]
AlphaFold Q5XPT3
Predicted Effect probably damaging
Transcript: ENSMUST00000068586
AA Change: S89P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000064128
Gene: ENSMUSG00000040434
AA Change: S89P

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
low complexity region 52 63 N/A INTRINSIC
Pfam:Glyco_transf_8 70 316 4.6e-22 PFAM
low complexity region 392 401 N/A INTRINSIC
Pfam:Glyco_transf_49 402 469 2.2e-11 PFAM
Pfam:Glyco_transf_49 466 673 1e-42 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000090582
AA Change: S89P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000088070
Gene: ENSMUSG00000040434
AA Change: S89P

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
low complexity region 52 63 N/A INTRINSIC
Pfam:Glyco_transf_8 70 218 7.2e-9 PFAM
Pfam:Glyco_transf_8 188 281 2.3e-8 PFAM
low complexity region 357 366 N/A INTRINSIC
Pfam:Glyco_transf_49 367 434 2.1e-11 PFAM
Pfam:Glyco_transf_49 431 638 9.3e-43 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000111284
AA Change: S114P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000106915
Gene: ENSMUSG00000040434
AA Change: S114P

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
low complexity region 77 88 N/A INTRINSIC
Pfam:Glyco_transf_8 97 341 8.9e-22 PFAM
low complexity region 417 426 N/A INTRINSIC
Pfam:Glyco_transf_49 427 494 6.5e-11 PFAM
Pfam:Glyco_transf_49 491 698 3.1e-42 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000148352
SMART Domains Protein: ENSMUSP00000135451
Gene: ENSMUSG00000040434

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
low complexity region 52 63 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000176289
SMART Domains Protein: ENSMUSP00000135118
Gene: ENSMUSG00000040434

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
low complexity region 52 63 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000176339
AA Change: S112P

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000135619
Gene: ENSMUSG00000040434
AA Change: S112P

DomainStartEndE-ValueType
transmembrane domain 31 50 N/A INTRINSIC
low complexity region 74 85 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000176774
AA Change: S90P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000135400
Gene: ENSMUSG00000040434
AA Change: S90P

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
low complexity region 52 63 N/A INTRINSIC
Pfam:Glyco_transf_8 71 317 3.9e-22 PFAM
low complexity region 393 402 N/A INTRINSIC
Pfam:Glyco_transf_49 403 470 1.6e-11 PFAM
Pfam:Glyco_transf_49 467 674 7.4e-43 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000176810
AA Change: S114P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000135024
Gene: ENSMUSG00000040434
AA Change: S114P

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
low complexity region 77 88 N/A INTRINSIC
Pfam:Glyco_transf_8 101 342 4.2e-20 PFAM
low complexity region 417 426 N/A INTRINSIC
Pfam:Glyco_transf_49 427 493 1.3e-13 PFAM
Pfam:Glyco_transf_49 489 698 2.8e-46 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 98% (47/48)
MGI Phenotype PHENOTYPE: Null mutant mice are healthy and are indistinguishable from control littermates with respect to body weight and life span when aged up to one year. No increased spontaneous tumor load was observed. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5430403G16Rik G A 5: 109,690,788 probably benign Het
Adamts9 A C 6: 92,937,338 D196E probably benign Het
Adnp A T 2: 168,183,466 D636E probably damaging Het
Afdn T C 17: 13,849,238 V723A probably damaging Het
Arid1a A T 4: 133,680,351 F1897I unknown Het
Atp6v0b T C 4: 117,885,286 M137V probably benign Het
Bicd1 T A 6: 149,519,004 I784N probably damaging Het
Cckbr A G 7: 105,433,786 T119A probably benign Het
Creb5 T C 6: 53,681,237 L184P probably damaging Het
Cyp2a22 T G 7: 26,938,148 K141Q possibly damaging Het
D16Ertd472e T C 16: 78,546,557 T219A possibly damaging Het
Ep400 A T 5: 110,756,025 L236Q unknown Het
Exph5 A G 9: 53,372,557 S313G possibly damaging Het
Gm10024 T C 10: 77,711,563 V36A unknown Het
Gm5493 A G 17: 22,747,274 E44G probably damaging Het
Gtdc1 A T 2: 44,790,005 probably null Het
Invs T C 4: 48,421,909 V847A probably benign Het
Kif18b C A 11: 102,914,722 Q236H probably damaging Het
Kntc1 A G 5: 123,816,755 T2079A probably benign Het
Maml3 A C 3: 51,856,768 D258E probably benign Het
Mdga2 A T 12: 66,506,255 M868K probably damaging Het
Mtss1l A G 8: 110,726,213 E30G possibly damaging Het
Muc16 T C 9: 18,645,614 I3128V unknown Het
Mug2 C T 6: 122,063,711 T740I probably damaging Het
Noc2l T C 4: 156,245,449 V612A probably benign Het
Olfr420 G A 1: 174,158,771 probably null Het
Olfr979 A T 9: 40,000,422 D268E probably damaging Het
Padi6 T C 4: 140,728,929 T585A probably benign Het
Pcdhga1 A T 18: 37,662,177 N78I probably damaging Het
Pdgfd A G 9: 6,293,894 Y156C probably damaging Het
Peg10 GCACATCAGGATCC GCACATCAGGATCCCCATCAGGATCCTCCACATCAGGATCC 6: 4,756,452 probably benign Het
Pi4ka C T 16: 17,301,060 V1307I Het
Pip5k1c A G 10: 81,308,960 N212D probably damaging Het
Plekha1 A G 7: 130,910,865 T264A probably benign Het
Polr2b A G 5: 77,326,704 R463G probably damaging Het
Psd2 T G 18: 35,979,997 D248E probably benign Het
Rag1 G T 2: 101,643,304 Q498K possibly damaging Het
Ryr3 A G 2: 112,753,027 I2853T probably damaging Het
Selenow G T 7: 15,922,382 probably null Het
Sned1 C T 1: 93,256,545 S165F probably benign Het
Spata31d1a A G 13: 59,704,139 probably null Het
Taar4 C A 10: 23,961,154 H221N probably damaging Het
Tgm6 A T 2: 130,141,285 R265W probably damaging Het
Trpm1 A T 7: 64,204,555 Q275L probably benign Het
Ulk3 T C 9: 57,592,042 L173P probably damaging Het
Urah A T 7: 140,835,627 T3S probably benign Het
Vmn1r149 A T 7: 22,437,904 V109D probably damaging Het
Xpc A T 6: 91,498,017 probably benign Het
Zglp1 T A 9: 21,062,708 K227N probably damaging Het
Other mutations in Large2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01143:Large2 APN 2 92366339 missense probably damaging 1.00
IGL01152:Large2 APN 2 92370639 missense probably damaging 1.00
IGL01377:Large2 APN 2 92369331 missense probably damaging 1.00
IGL01764:Large2 APN 2 92367186 splice site probably benign
IGL02016:Large2 APN 2 92369543 missense possibly damaging 0.82
IGL02396:Large2 APN 2 92366323 nonsense probably null
IGL02996:Large2 APN 2 92365928 missense possibly damaging 0.88
IGL03011:Large2 APN 2 92367582 missense probably damaging 1.00
egged UTSW 2 92370508 intron probably benign
P0041:Large2 UTSW 2 92367254 splice site probably benign
R1915:Large2 UTSW 2 92365825 splice site probably benign
R4193:Large2 UTSW 2 92365359 missense probably damaging 1.00
R4239:Large2 UTSW 2 92366605 splice site probably benign
R4580:Large2 UTSW 2 92370612 missense possibly damaging 0.66
R4679:Large2 UTSW 2 92367558 missense probably benign 0.31
R4857:Large2 UTSW 2 92366634 intron probably benign
R4918:Large2 UTSW 2 92366107 intron probably benign
R5050:Large2 UTSW 2 92367779 missense probably benign 0.05
R5237:Large2 UTSW 2 92367142 missense probably benign 0.16
R5264:Large2 UTSW 2 92374743 unclassified probably benign
R5508:Large2 UTSW 2 92369903 missense possibly damaging 0.80
R5999:Large2 UTSW 2 92366058 missense probably benign 0.01
R6077:Large2 UTSW 2 92366570 missense probably benign 0.00
R6167:Large2 UTSW 2 92367088 missense probably benign 0.44
R6218:Large2 UTSW 2 92370636 missense probably damaging 0.99
R6225:Large2 UTSW 2 92366480 missense probably damaging 1.00
R6301:Large2 UTSW 2 92369516 missense probably damaging 1.00
R6376:Large2 UTSW 2 92370508 intron probably benign
R6485:Large2 UTSW 2 92366028 missense probably benign
R6727:Large2 UTSW 2 92370870 utr 5 prime probably benign
R6942:Large2 UTSW 2 92370822 missense probably damaging 0.99
R7051:Large2 UTSW 2 92367022 missense probably damaging 0.97
R7318:Large2 UTSW 2 92366028 missense probably benign
R7640:Large2 UTSW 2 92374705 start codon destroyed probably null
R9522:Large2 UTSW 2 92369921 missense probably damaging 1.00
Z1176:Large2 UTSW 2 92370198 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TAACATGGCTGTGCGGGAAC -3'
(R):5'- GAAATTGAGGCGTTGCATCTAGG -3'

Sequencing Primer
(F):5'- TGCGGGAACAATACAGGATTCTCC -3'
(R):5'- CGTTGCATCTAGGCACCC -3'
Posted On 2019-10-24