Mutagenetix > Incidental Mutations

Incidental Mutation 'R7581:Padi6'

586733

Institutional Source

Beutler Lab

Gene Symbol

Padi6

Ensembl Gene

ENSMUSG00000040935

Gene Name

peptidyl arginine deiminase, type VI

Synonyms

Padi5, Pad6, ePAD

MMRRC Submission

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7581 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

140727355-140742643 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 140728929 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 585 (T585A)

Ref Sequence

ENSEMBL: ENSMUSP00000044044 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000038749]

AlphaFold

Q8K3V4

Predicted Effect

probably benign
Transcript: ENSMUST00000038749
AA Change: T585A

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)

SMART Domains

Protein: ENSMUSP00000044044
Gene: ENSMUSG00000040935
AA Change: T585A

Domain	Start	End	E-Value	Type
Pfam:PAD_N	1	112	5.6e-38	PFAM
Pfam:PAD_M	114	269	6e-53	PFAM
Pfam:PAD	280	679	4.7e-149	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000125046

Meta Mutation Damage Score

0.0750

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.2%

Validation Efficiency

98% (47/48)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the peptidyl arginine deiminase family of enzymes, which catalyze the post-translational deimination of proteins by converting arginine residues into citrullines in the presence of calcium ions. The family members have distinct substrate specificities and tissue-specific expression patterns. This protein may play a role in cytoskeletal reorganization in the egg and in early embryo development. [provided by RefSeq, Sep 2012]
PHENOTYPE: Mice homozygous for a null allele exhibit altered oocyte cytoplasmic structures that lead to a failure of zygotes to progress beyond the 2 cell stage and female infertility. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 49 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
5430403G16Rik	G	A	5: 109,690,788		probably benign	Het
Adamts9	A	C	6: 92,937,338	D196E	probably benign	Het
Adnp	A	T	2: 168,183,466	D636E	probably damaging	Het
Afdn	T	C	17: 13,849,238	V723A	probably damaging	Het
Arid1a	A	T	4: 133,680,351	F1897I	unknown	Het
Atp6v0b	T	C	4: 117,885,286	M137V	probably benign	Het
Bicd1	T	A	6: 149,519,004	I784N	probably damaging	Het
Cckbr	A	G	7: 105,433,786	T119A	probably benign	Het
Creb5	T	C	6: 53,681,237	L184P	probably damaging	Het
Cyp2a22	T	G	7: 26,938,148	K141Q	possibly damaging	Het
D16Ertd472e	T	C	16: 78,546,557	T219A	possibly damaging	Het
Ep400	A	T	5: 110,756,025	L236Q	unknown	Het
Exph5	A	G	9: 53,372,557	S313G	possibly damaging	Het
Gm10024	T	C	10: 77,711,563	V36A	unknown	Het
Gm5493	A	G	17: 22,747,274	E44G	probably damaging	Het
Gtdc1	A	T	2: 44,790,005		probably null	Het
Invs	T	C	4: 48,421,909	V847A	probably benign	Het
Kif18b	C	A	11: 102,914,722	Q236H	probably damaging	Het
Kntc1	A	G	5: 123,816,755	T2079A	probably benign	Het
Large2	A	G	2: 92,370,193	S89P	probably damaging	Het
Maml3	A	C	3: 51,856,768	D258E	probably benign	Het
Mdga2	A	T	12: 66,506,255	M868K	probably damaging	Het
Mtss1l	A	G	8: 110,726,213	E30G	possibly damaging	Het
Muc16	T	C	9: 18,645,614	I3128V	unknown	Het
Mug2	C	T	6: 122,063,711	T740I	probably damaging	Het
Noc2l	T	C	4: 156,245,449	V612A	probably benign	Het
Olfr420	G	A	1: 174,158,771		probably null	Het
Olfr979	A	T	9: 40,000,422	D268E	probably damaging	Het
Pcdhga1	A	T	18: 37,662,177	N78I	probably damaging	Het
Pdgfd	A	G	9: 6,293,894	Y156C	probably damaging	Het
Peg10	GCACATCAGGATCC	GCACATCAGGATCCCCATCAGGATCCTCCACATCAGGATCC	6: 4,756,452		probably benign	Het
Pi4ka	C	T	16: 17,301,060	V1307I		Het
Pip5k1c	A	G	10: 81,308,960	N212D	probably damaging	Het
Plekha1	A	G	7: 130,910,865	T264A	probably benign	Het
Polr2b	A	G	5: 77,326,704	R463G	probably damaging	Het
Psd2	T	G	18: 35,979,997	D248E	probably benign	Het
Rag1	G	T	2: 101,643,304	Q498K	possibly damaging	Het
Ryr3	A	G	2: 112,753,027	I2853T	probably damaging	Het
Selenow	G	T	7: 15,922,382		probably null	Het
Sned1	C	T	1: 93,256,545	S165F	probably benign	Het
Spata31d1a	A	G	13: 59,704,139		probably null	Het
Taar4	C	A	10: 23,961,154	H221N	probably damaging	Het
Tgm6	A	T	2: 130,141,285	R265W	probably damaging	Het
Trpm1	A	T	7: 64,204,555	Q275L	probably benign	Het
Ulk3	T	C	9: 57,592,042	L173P	probably damaging	Het
Urah	A	T	7: 140,835,627	T3S	probably benign	Het
Vmn1r149	A	T	7: 22,437,904	V109D	probably damaging	Het
Xpc	A	T	6: 91,498,017		probably benign	Het
Zglp1	T	A	9: 21,062,708	K227N	probably damaging	Het

Other mutations in Padi6

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00778:Padi6	APN	4	140727623	missense	possibly damaging	0.56
IGL01013:Padi6	APN	4	140729003	missense	probably damaging	0.98
IGL01068:Padi6	APN	4	140730953	missense	possibly damaging	0.70
IGL01945:Padi6	APN	4	140741924	missense	probably benign	0.24
streetwise	UTSW	4	140741558	nonsense	probably null
R0097:Padi6	UTSW	4	140730957	missense	probably benign	0.09
R0097:Padi6	UTSW	4	140730957	missense	probably benign	0.09
R0135:Padi6	UTSW	4	140737352	missense	probably benign	0.04
R0437:Padi6	UTSW	4	140728929	missense	probably benign	0.01
R1581:Padi6	UTSW	4	140735836	missense	probably damaging	1.00
R2024:Padi6	UTSW	4	140728968	missense	possibly damaging	0.78
R3150:Padi6	UTSW	4	140735389	missense	probably damaging	1.00
R3176:Padi6	UTSW	4	140735389	missense	probably damaging	1.00
R3177:Padi6	UTSW	4	140735389	missense	probably damaging	1.00
R3276:Padi6	UTSW	4	140735389	missense	probably damaging	1.00
R3277:Padi6	UTSW	4	140735389	missense	probably damaging	1.00
R4168:Padi6	UTSW	4	140741934	missense	probably damaging	0.99
R4727:Padi6	UTSW	4	140731195	missense	probably damaging	1.00
R5063:Padi6	UTSW	4	140741880	missense	probably benign	0.01
R5382:Padi6	UTSW	4	140731210	missense	probably damaging	1.00
R5408:Padi6	UTSW	4	140727685	missense	probably damaging	1.00
R5604:Padi6	UTSW	4	140731162	missense	probably damaging	0.96
R5790:Padi6	UTSW	4	140732258	missense	probably damaging	1.00
R7084:Padi6	UTSW	4	140741558	nonsense	probably null
R7533:Padi6	UTSW	4	140731195	missense	probably damaging	1.00
R7662:Padi6	UTSW	4	140728995	missense	probably benign	0.00
R7766:Padi6	UTSW	4	140730975	missense	probably benign	0.02
R7872:Padi6	UTSW	4	140727762	missense	probably damaging	1.00
R8333:Padi6	UTSW	4	140737376	missense	probably damaging	1.00
R8347:Padi6	UTSW	4	140735408	missense	probably benign	0.00
R8550:Padi6	UTSW	4	140732703	missense	probably benign	0.15
R8979:Padi6	UTSW	4	140739163	missense	probably benign	0.03
RF007:Padi6	UTSW	4	140729743	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ACTAAGCACATGAACCTGGGG -3'
(R):5'- ACTCCTGGCTCACAAGATTTG -3'

Sequencing Primer
(F):5'- ATGAACCTGGGGGCCACAC -3'
(R):5'- AGCCAAATGGTTCTCTGGGAC -3'

Posted On

2019-10-24