Incidental Mutation 'R7581:Padi6'
ID 586733
Institutional Source Beutler Lab
Gene Symbol Padi6
Ensembl Gene ENSMUSG00000040935
Gene Name peptidyl arginine deiminase, type VI
Synonyms Padi5, Pad6, ePAD
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R7581 (G1)
Quality Score 225.009
Status Validated
Chromosome 4
Chromosomal Location 140727355-140742643 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 140728929 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 585 (T585A)
Ref Sequence ENSEMBL: ENSMUSP00000044044 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038749]
AlphaFold Q8K3V4
Predicted Effect probably benign
Transcript: ENSMUST00000038749
AA Change: T585A

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000044044
Gene: ENSMUSG00000040935
AA Change: T585A

DomainStartEndE-ValueType
Pfam:PAD_N 1 112 5.6e-38 PFAM
Pfam:PAD_M 114 269 6e-53 PFAM
Pfam:PAD 280 679 4.7e-149 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125046
Meta Mutation Damage Score 0.0750 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 98% (47/48)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the peptidyl arginine deiminase family of enzymes, which catalyze the post-translational deimination of proteins by converting arginine residues into citrullines in the presence of calcium ions. The family members have distinct substrate specificities and tissue-specific expression patterns. This protein may play a role in cytoskeletal reorganization in the egg and in early embryo development. [provided by RefSeq, Sep 2012]
PHENOTYPE: Mice homozygous for a null allele exhibit altered oocyte cytoplasmic structures that lead to a failure of zygotes to progress beyond the 2 cell stage and female infertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5430403G16Rik G A 5: 109,690,788 probably benign Het
Adamts9 A C 6: 92,937,338 D196E probably benign Het
Adnp A T 2: 168,183,466 D636E probably damaging Het
Afdn T C 17: 13,849,238 V723A probably damaging Het
Arid1a A T 4: 133,680,351 F1897I unknown Het
Atp6v0b T C 4: 117,885,286 M137V probably benign Het
Bicd1 T A 6: 149,519,004 I784N probably damaging Het
Cckbr A G 7: 105,433,786 T119A probably benign Het
Creb5 T C 6: 53,681,237 L184P probably damaging Het
Cyp2a22 T G 7: 26,938,148 K141Q possibly damaging Het
D16Ertd472e T C 16: 78,546,557 T219A possibly damaging Het
Ep400 A T 5: 110,756,025 L236Q unknown Het
Exph5 A G 9: 53,372,557 S313G possibly damaging Het
Gm10024 T C 10: 77,711,563 V36A unknown Het
Gm5493 A G 17: 22,747,274 E44G probably damaging Het
Gtdc1 A T 2: 44,790,005 probably null Het
Invs T C 4: 48,421,909 V847A probably benign Het
Kif18b C A 11: 102,914,722 Q236H probably damaging Het
Kntc1 A G 5: 123,816,755 T2079A probably benign Het
Large2 A G 2: 92,370,193 S89P probably damaging Het
Maml3 A C 3: 51,856,768 D258E probably benign Het
Mdga2 A T 12: 66,506,255 M868K probably damaging Het
Mtss1l A G 8: 110,726,213 E30G possibly damaging Het
Muc16 T C 9: 18,645,614 I3128V unknown Het
Mug2 C T 6: 122,063,711 T740I probably damaging Het
Noc2l T C 4: 156,245,449 V612A probably benign Het
Olfr420 G A 1: 174,158,771 probably null Het
Olfr979 A T 9: 40,000,422 D268E probably damaging Het
Pcdhga1 A T 18: 37,662,177 N78I probably damaging Het
Pdgfd A G 9: 6,293,894 Y156C probably damaging Het
Peg10 GCACATCAGGATCC GCACATCAGGATCCCCATCAGGATCCTCCACATCAGGATCC 6: 4,756,452 probably benign Het
Pi4ka C T 16: 17,301,060 V1307I Het
Pip5k1c A G 10: 81,308,960 N212D probably damaging Het
Plekha1 A G 7: 130,910,865 T264A probably benign Het
Polr2b A G 5: 77,326,704 R463G probably damaging Het
Psd2 T G 18: 35,979,997 D248E probably benign Het
Rag1 G T 2: 101,643,304 Q498K possibly damaging Het
Ryr3 A G 2: 112,753,027 I2853T probably damaging Het
Selenow G T 7: 15,922,382 probably null Het
Sned1 C T 1: 93,256,545 S165F probably benign Het
Spata31d1a A G 13: 59,704,139 probably null Het
Taar4 C A 10: 23,961,154 H221N probably damaging Het
Tgm6 A T 2: 130,141,285 R265W probably damaging Het
Trpm1 A T 7: 64,204,555 Q275L probably benign Het
Ulk3 T C 9: 57,592,042 L173P probably damaging Het
Urah A T 7: 140,835,627 T3S probably benign Het
Vmn1r149 A T 7: 22,437,904 V109D probably damaging Het
Xpc A T 6: 91,498,017 probably benign Het
Zglp1 T A 9: 21,062,708 K227N probably damaging Het
Other mutations in Padi6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00778:Padi6 APN 4 140727623 missense possibly damaging 0.56
IGL01013:Padi6 APN 4 140729003 missense probably damaging 0.98
IGL01068:Padi6 APN 4 140730953 missense possibly damaging 0.70
IGL01945:Padi6 APN 4 140741924 missense probably benign 0.24
streetwise UTSW 4 140741558 nonsense probably null
R0097:Padi6 UTSW 4 140730957 missense probably benign 0.09
R0097:Padi6 UTSW 4 140730957 missense probably benign 0.09
R0135:Padi6 UTSW 4 140737352 missense probably benign 0.04
R0437:Padi6 UTSW 4 140728929 missense probably benign 0.01
R1581:Padi6 UTSW 4 140735836 missense probably damaging 1.00
R2024:Padi6 UTSW 4 140728968 missense possibly damaging 0.78
R3150:Padi6 UTSW 4 140735389 missense probably damaging 1.00
R3176:Padi6 UTSW 4 140735389 missense probably damaging 1.00
R3177:Padi6 UTSW 4 140735389 missense probably damaging 1.00
R3276:Padi6 UTSW 4 140735389 missense probably damaging 1.00
R3277:Padi6 UTSW 4 140735389 missense probably damaging 1.00
R4168:Padi6 UTSW 4 140741934 missense probably damaging 0.99
R4727:Padi6 UTSW 4 140731195 missense probably damaging 1.00
R5063:Padi6 UTSW 4 140741880 missense probably benign 0.01
R5382:Padi6 UTSW 4 140731210 missense probably damaging 1.00
R5408:Padi6 UTSW 4 140727685 missense probably damaging 1.00
R5604:Padi6 UTSW 4 140731162 missense probably damaging 0.96
R5790:Padi6 UTSW 4 140732258 missense probably damaging 1.00
R7084:Padi6 UTSW 4 140741558 nonsense probably null
R7533:Padi6 UTSW 4 140731195 missense probably damaging 1.00
R7662:Padi6 UTSW 4 140728995 missense probably benign 0.00
R7766:Padi6 UTSW 4 140730975 missense probably benign 0.02
R7872:Padi6 UTSW 4 140727762 missense probably damaging 1.00
R8333:Padi6 UTSW 4 140737376 missense probably damaging 1.00
R8347:Padi6 UTSW 4 140735408 missense probably benign 0.00
R8550:Padi6 UTSW 4 140732703 missense probably benign 0.15
R8979:Padi6 UTSW 4 140739163 missense probably benign 0.03
RF007:Padi6 UTSW 4 140729743 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACTAAGCACATGAACCTGGGG -3'
(R):5'- ACTCCTGGCTCACAAGATTTG -3'

Sequencing Primer
(F):5'- ATGAACCTGGGGGCCACAC -3'
(R):5'- AGCCAAATGGTTCTCTGGGAC -3'
Posted On 2019-10-24