Incidental Mutation 'R7581:Noc2l'
ID 586734
Institutional Source Beutler Lab
Gene Symbol Noc2l
Ensembl Gene ENSMUSG00000095567
Gene Name NOC2 like nucleolar associated transcriptional repressor
Synonyms NIR
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R7581 (G1)
Quality Score 225.009
Status Validated
Chromosome 4
Chromosomal Location 156236010-156247616 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 156245449 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 612 (V612A)
Ref Sequence ENSEMBL: ENSMUSP00000137253 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000179543] [ENSMUST00000179886] [ENSMUST00000179919] [ENSMUST00000217934] [ENSMUST00000218788] [ENSMUST00000219393] [ENSMUST00000220228]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000179543
AA Change: V612A

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000137253
Gene: ENSMUSG00000095567
AA Change: V612A

DomainStartEndE-ValueType
low complexity region 21 58 N/A INTRINSIC
low complexity region 97 114 N/A INTRINSIC
low complexity region 121 139 N/A INTRINSIC
Pfam:Noc2 331 626 1.8e-128 PFAM
low complexity region 651 675 N/A INTRINSIC
low complexity region 701 723 N/A INTRINSIC
low complexity region 738 750 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000179886
AA Change: V455A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000137183
Gene: ENSMUSG00000095567
AA Change: V455A

DomainStartEndE-ValueType
Pfam:Noc2 172 470 1.2e-117 PFAM
low complexity region 494 518 N/A INTRINSIC
low complexity region 544 566 N/A INTRINSIC
low complexity region 581 593 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000179919
SMART Domains Protein: ENSMUSP00000136611
Gene: ENSMUSG00000096351

DomainStartEndE-ValueType
low complexity region 277 295 N/A INTRINSIC
low complexity region 365 385 N/A INTRINSIC
low complexity region 401 410 N/A INTRINSIC
SAM 411 478 1.82e-6 SMART
low complexity region 486 503 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000217934
Predicted Effect probably benign
Transcript: ENSMUST00000218788
Predicted Effect probably benign
Transcript: ENSMUST00000219393
Predicted Effect probably benign
Transcript: ENSMUST00000220228
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 98% (47/48)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Histone modification by histone acetyltransferases (HAT) and histone deacetylases (HDAC) can control major aspects of transcriptional regulation. NOC2L represents a novel HDAC-independent inhibitor of histone acetyltransferase (INHAT) (Hublitz et al., 2005 [PubMed 16322561]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice lacking expression of this gene display embryonic lethality prior to the tooth bud stage. Mice with an immune cell deletion display impaired T and B cell differentiation with a cell cycle defect. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5430403G16Rik G A 5: 109,690,788 probably benign Het
Adamts9 A C 6: 92,937,338 D196E probably benign Het
Adnp A T 2: 168,183,466 D636E probably damaging Het
Afdn T C 17: 13,849,238 V723A probably damaging Het
Arid1a A T 4: 133,680,351 F1897I unknown Het
Atp6v0b T C 4: 117,885,286 M137V probably benign Het
Bicd1 T A 6: 149,519,004 I784N probably damaging Het
Cckbr A G 7: 105,433,786 T119A probably benign Het
Creb5 T C 6: 53,681,237 L184P probably damaging Het
Cyp2a22 T G 7: 26,938,148 K141Q possibly damaging Het
D16Ertd472e T C 16: 78,546,557 T219A possibly damaging Het
Ep400 A T 5: 110,756,025 L236Q unknown Het
Exph5 A G 9: 53,372,557 S313G possibly damaging Het
Gm10024 T C 10: 77,711,563 V36A unknown Het
Gm5493 A G 17: 22,747,274 E44G probably damaging Het
Gtdc1 A T 2: 44,790,005 probably null Het
Invs T C 4: 48,421,909 V847A probably benign Het
Kif18b C A 11: 102,914,722 Q236H probably damaging Het
Kntc1 A G 5: 123,816,755 T2079A probably benign Het
Large2 A G 2: 92,370,193 S89P probably damaging Het
Maml3 A C 3: 51,856,768 D258E probably benign Het
Mdga2 A T 12: 66,506,255 M868K probably damaging Het
Mtss1l A G 8: 110,726,213 E30G possibly damaging Het
Muc16 T C 9: 18,645,614 I3128V unknown Het
Mug2 C T 6: 122,063,711 T740I probably damaging Het
Olfr420 G A 1: 174,158,771 probably null Het
Olfr979 A T 9: 40,000,422 D268E probably damaging Het
Padi6 T C 4: 140,728,929 T585A probably benign Het
Pcdhga1 A T 18: 37,662,177 N78I probably damaging Het
Pdgfd A G 9: 6,293,894 Y156C probably damaging Het
Peg10 GCACATCAGGATCC GCACATCAGGATCCCCATCAGGATCCTCCACATCAGGATCC 6: 4,756,452 probably benign Het
Pi4ka C T 16: 17,301,060 V1307I Het
Pip5k1c A G 10: 81,308,960 N212D probably damaging Het
Plekha1 A G 7: 130,910,865 T264A probably benign Het
Polr2b A G 5: 77,326,704 R463G probably damaging Het
Psd2 T G 18: 35,979,997 D248E probably benign Het
Rag1 G T 2: 101,643,304 Q498K possibly damaging Het
Ryr3 A G 2: 112,753,027 I2853T probably damaging Het
Selenow G T 7: 15,922,382 probably null Het
Sned1 C T 1: 93,256,545 S165F probably benign Het
Spata31d1a A G 13: 59,704,139 probably null Het
Taar4 C A 10: 23,961,154 H221N probably damaging Het
Tgm6 A T 2: 130,141,285 R265W probably damaging Het
Trpm1 A T 7: 64,204,555 Q275L probably benign Het
Ulk3 T C 9: 57,592,042 L173P probably damaging Het
Urah A T 7: 140,835,627 T3S probably benign Het
Vmn1r149 A T 7: 22,437,904 V109D probably damaging Het
Xpc A T 6: 91,498,017 probably benign Het
Zglp1 T A 9: 21,062,708 K227N probably damaging Het
Other mutations in Noc2l
AlleleSourceChrCoordTypePredicted EffectPPH Score
FR4304:Noc2l UTSW 4 156240096 small insertion probably benign
FR4449:Noc2l UTSW 4 156240101 small insertion probably benign
FR4548:Noc2l UTSW 4 156240092 small insertion probably benign
FR4548:Noc2l UTSW 4 156240100 small insertion probably benign
FR4737:Noc2l UTSW 4 156240094 small insertion probably benign
FR4737:Noc2l UTSW 4 156240095 small insertion probably benign
FR4737:Noc2l UTSW 4 156241501 critical splice donor site probably benign
FR4976:Noc2l UTSW 4 156240092 small insertion probably benign
FR4976:Noc2l UTSW 4 156240098 small insertion probably benign
R1577:Noc2l UTSW 4 156240622 missense probably damaging 1.00
R1633:Noc2l UTSW 4 156245293 missense probably benign 0.20
R1858:Noc2l UTSW 4 156245270 missense probably damaging 1.00
R1862:Noc2l UTSW 4 156237708 missense probably benign 0.00
R2069:Noc2l UTSW 4 156241450 nonsense probably null
R2862:Noc2l UTSW 4 156237450 missense probably benign 0.30
R4092:Noc2l UTSW 4 156242576 missense probably damaging 1.00
R4369:Noc2l UTSW 4 156237396 missense possibly damaging 0.68
R4964:Noc2l UTSW 4 156245911 missense probably damaging 0.98
R4966:Noc2l UTSW 4 156245911 missense probably damaging 0.98
R5922:Noc2l UTSW 4 156241313 nonsense probably null
R7081:Noc2l UTSW 4 156247020 missense possibly damaging 0.80
R7171:Noc2l UTSW 4 156241722 missense probably benign 0.05
R7315:Noc2l UTSW 4 156241360 missense probably damaging 0.98
R7317:Noc2l UTSW 4 156239216 missense possibly damaging 0.93
R7690:Noc2l UTSW 4 156237631 missense probably benign 0.01
R7693:Noc2l UTSW 4 156240307 missense probably damaging 1.00
R8527:Noc2l UTSW 4 156241730 missense probably benign 0.05
R8542:Noc2l UTSW 4 156241730 missense probably benign 0.05
R9081:Noc2l UTSW 4 156241767 missense probably damaging 1.00
R9344:Noc2l UTSW 4 156240673 missense probably damaging 1.00
R9393:Noc2l UTSW 4 156236327 critical splice donor site probably null
R9406:Noc2l UTSW 4 156236054 missense probably benign 0.00
R9439:Noc2l UTSW 4 156241673 missense possibly damaging 0.62
R9448:Noc2l UTSW 4 156236324 missense probably benign
Predicted Primers PCR Primer
(F):5'- CAAAGTCTTCGACAGAGCGC -3'
(R):5'- TACAGGGTTCACTCAAACTCAC -3'

Sequencing Primer
(F):5'- TTCGACAGAGCGCGACCTTC -3'
(R):5'- AGGGTTCACTCAAACTCACCTTTC -3'
Posted On 2019-10-24