Incidental Mutation 'R7581:Peg10'
ID 586739
Institutional Source Beutler Lab
Gene Symbol Peg10
Ensembl Gene ENSMUSG00000092035
Gene Name paternally expressed 10
Synonyms MEF3L, MyEF-3 like, Rtl2, Mar2, MyEF-3, HB-1, Edr, Mart2
MMRRC Submission 045634-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R7581 (G1)
Quality Score 214.458
Status Not validated
Chromosome 6
Chromosomal Location 4747306-4760517 bp(+) (GRCm39)
Type of Mutation small insertion (9 aa in frame mutation)
DNA Base Change (assembly) GCACATCAGGATCC to GCACATCAGGATCCCCATCAGGATCCTCCACATCAGGATCC at 4756452 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000135076 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000166678] [ENSMUST00000176204] [ENSMUST00000176551]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000166678
SMART Domains Protein: ENSMUSP00000127306
Gene: ENSMUSG00000092035

DomainStartEndE-ValueType
low complexity region 11 26 N/A INTRINSIC
low complexity region 34 50 N/A INTRINSIC
low complexity region 80 107 N/A INTRINSIC
Pfam:DUF4939 130 220 6.1e-17 PFAM
Pfam:Retrotrans_gag 174 267 2.9e-20 PFAM
low complexity region 334 342 N/A INTRINSIC
ZnF_C2HC 345 361 3.34e-2 SMART
low complexity region 368 379 N/A INTRINSIC
low complexity region 541 610 N/A INTRINSIC
low complexity region 621 660 N/A INTRINSIC
low complexity region 663 785 N/A INTRINSIC
Blast:SERPIN 798 910 1e-5 BLAST
low complexity region 923 936 N/A INTRINSIC
low complexity region 972 998 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000176204
SMART Domains Protein: ENSMUSP00000134963
Gene: ENSMUSG00000092035

DomainStartEndE-ValueType
low complexity region 11 26 N/A INTRINSIC
low complexity region 34 50 N/A INTRINSIC
low complexity region 80 107 N/A INTRINSIC
Pfam:Retrotrans_gag 174 267 1.3e-20 PFAM
low complexity region 334 342 N/A INTRINSIC
ZnF_C2HC 345 361 3.34e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000176551
SMART Domains Protein: ENSMUSP00000135076
Gene: ENSMUSG00000092035

DomainStartEndE-ValueType
low complexity region 173 242 N/A INTRINSIC
low complexity region 253 292 N/A INTRINSIC
low complexity region 295 417 N/A INTRINSIC
Blast:SERPIN 430 542 6e-6 BLAST
low complexity region 555 568 N/A INTRINSIC
low complexity region 604 630 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 98% (47/48)
MGI Phenotype FUNCTION: This is a paternally expressed imprinted gene that is thought to have been derived from the Ty3/Gypsy family of retrotransposons. It contains two overlapping open reading frames, RF1 and RF2, and expresses two proteins: a shorter, gag-like protein (with a CCHC-type zinc finger domain) from RF1; and a longer, gag/pol-like fusion protein (with an additional aspartic protease motif) from RF1/RF2 by -1 translational frameshifting (-1 FS). While -1 FS has been observed in RNA viruses and transposons in both prokaryotes and eukaryotes, this gene represents the first example of -1 FS in a eukaryotic cellular gene. This gene is highly conserved across mammalian species and retains the heptanucleotide (GGGAAAC) and pseudoknot elements required for -1 FS. It is expressed in adult and embryonic tissues (most notably in placenta) and reported to have a role in cell proliferation, differentiation, apoptosis and cancer development. Knockout mice lacking this gene showed early embryonic lethality with placental defects, indicating the importance of this gene in embryonic development. [provided by RefSeq, Oct 2014]
PHENOTYPE: Heterozygous mice with a paternally inherited null allele display embryonic lethality during organogenesis with abnormal placental development. Heterozygous mice with a maternally inherited null allele are viable and fertile. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts9 A C 6: 92,914,319 (GRCm39) D196E probably benign Het
Adnp A T 2: 168,025,386 (GRCm39) D636E probably damaging Het
Afdn T C 17: 14,069,500 (GRCm39) V723A probably damaging Het
Arid1a A T 4: 133,407,662 (GRCm39) F1897I unknown Het
Atp6v0b T C 4: 117,742,483 (GRCm39) M137V probably benign Het
Bicd1 T A 6: 149,420,502 (GRCm39) I784N probably damaging Het
Cckbr A G 7: 105,082,993 (GRCm39) T119A probably benign Het
Creb5 T C 6: 53,658,222 (GRCm39) L184P probably damaging Het
Cyp2a22 T G 7: 26,637,573 (GRCm39) K141Q possibly damaging Het
D16Ertd472e T C 16: 78,343,445 (GRCm39) T219A possibly damaging Het
Ep400 A T 5: 110,903,891 (GRCm39) L236Q unknown Het
Exph5 A G 9: 53,283,857 (GRCm39) S313G possibly damaging Het
Gm10024 T C 10: 77,547,397 (GRCm39) V36A unknown Het
Gm5493 A G 17: 22,966,247 (GRCm39) E44G probably damaging Het
Gtdc1 A T 2: 44,680,017 (GRCm39) probably null Het
Invs T C 4: 48,421,909 (GRCm39) V847A probably benign Het
Kif18b C A 11: 102,805,548 (GRCm39) Q236H probably damaging Het
Kntc1 A G 5: 123,954,818 (GRCm39) T2079A probably benign Het
Large2 A G 2: 92,200,538 (GRCm39) S89P probably damaging Het
Maml3 A C 3: 51,764,189 (GRCm39) D258E probably benign Het
Mdga2 A T 12: 66,553,029 (GRCm39) M868K probably damaging Het
Mtss2 A G 8: 111,452,845 (GRCm39) E30G possibly damaging Het
Muc16 T C 9: 18,556,910 (GRCm39) I3128V unknown Het
Mug2 C T 6: 122,040,670 (GRCm39) T740I probably damaging Het
Noc2l T C 4: 156,329,906 (GRCm39) V612A probably benign Het
Or10g9 A T 9: 39,911,718 (GRCm39) D268E probably damaging Het
Or6k2 G A 1: 173,986,337 (GRCm39) probably null Het
Padi6 T C 4: 140,456,240 (GRCm39) T585A probably benign Het
Pcdhga1 A T 18: 37,795,230 (GRCm39) N78I probably damaging Het
Pdgfd A G 9: 6,293,894 (GRCm39) Y156C probably damaging Het
Pi4ka C T 16: 17,118,924 (GRCm39) V1307I Het
Pip5k1c A G 10: 81,144,794 (GRCm39) N212D probably damaging Het
Plekha1 A G 7: 130,512,595 (GRCm39) T264A probably benign Het
Polr2b A G 5: 77,474,551 (GRCm39) R463G probably damaging Het
Psd2 T G 18: 36,113,050 (GRCm39) D248E probably benign Het
Rag1 G T 2: 101,473,649 (GRCm39) Q498K possibly damaging Het
Ryr3 A G 2: 112,583,372 (GRCm39) I2853T probably damaging Het
Selenow G T 7: 15,656,307 (GRCm39) probably null Het
Sned1 C T 1: 93,184,267 (GRCm39) S165F probably benign Het
Spata31d1a A G 13: 59,851,953 (GRCm39) probably null Het
Taar4 C A 10: 23,837,052 (GRCm39) H221N probably damaging Het
Tgm6 A T 2: 129,983,205 (GRCm39) R265W probably damaging Het
Trpm1 A T 7: 63,854,303 (GRCm39) Q275L probably benign Het
Ulk3 T C 9: 57,499,325 (GRCm39) L173P probably damaging Het
Urah A T 7: 140,415,540 (GRCm39) T3S probably benign Het
Vmn1r149 A T 7: 22,137,329 (GRCm39) V109D probably damaging Het
Xpc A T 6: 91,474,999 (GRCm39) probably benign Het
Zfp1007 G A 5: 109,838,654 (GRCm39) probably benign Het
Zglp1 T A 9: 20,974,004 (GRCm39) K227N probably damaging Het
Other mutations in Peg10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02029:Peg10 APN 6 4,754,473 (GRCm39) utr 5 prime probably benign
IGL03063:Peg10 APN 6 4,756,647 (GRCm39) utr 3 prime probably benign
piaggio UTSW 6 4,756,427 (GRCm39) utr 3 prime probably benign
PIT4480001:Peg10 UTSW 6 4,756,560 (GRCm39) missense unknown
R0090:Peg10 UTSW 6 4,756,063 (GRCm39) utr 3 prime probably benign
R0148:Peg10 UTSW 6 4,755,711 (GRCm39) missense possibly damaging 0.88
R0650:Peg10 UTSW 6 4,756,475 (GRCm39) small insertion probably benign
R0698:Peg10 UTSW 6 4,756,835 (GRCm39) utr 3 prime probably benign
R1600:Peg10 UTSW 6 4,757,080 (GRCm39) utr 3 prime probably benign
R1842:Peg10 UTSW 6 4,756,381 (GRCm39) utr 3 prime probably benign
R1930:Peg10 UTSW 6 4,755,778 (GRCm39) missense probably damaging 0.99
R1931:Peg10 UTSW 6 4,755,778 (GRCm39) missense probably damaging 0.99
R2162:Peg10 UTSW 6 4,755,914 (GRCm39) utr 3 prime probably benign
R2215:Peg10 UTSW 6 4,756,918 (GRCm39) utr 3 prime probably benign
R2339:Peg10 UTSW 6 4,756,102 (GRCm39) utr 3 prime probably benign
R2847:Peg10 UTSW 6 4,756,912 (GRCm39) utr 3 prime probably benign
R2848:Peg10 UTSW 6 4,756,912 (GRCm39) utr 3 prime probably benign
R3000:Peg10 UTSW 6 4,754,276 (GRCm39) utr 5 prime probably benign
R3056:Peg10 UTSW 6 4,755,029 (GRCm39) missense possibly damaging 0.66
R4051:Peg10 UTSW 6 4,754,534 (GRCm39) missense probably benign 0.00
R4059:Peg10 UTSW 6 4,756,427 (GRCm39) utr 3 prime probably benign
R4296:Peg10 UTSW 6 4,756,472 (GRCm39) small insertion probably benign
R4626:Peg10 UTSW 6 4,756,460 (GRCm39) small insertion probably benign
R4634:Peg10 UTSW 6 4,756,452 (GRCm39) small insertion probably benign
R4679:Peg10 UTSW 6 4,756,452 (GRCm39) small insertion probably benign
R4834:Peg10 UTSW 6 4,754,294 (GRCm39) utr 5 prime probably benign
R4982:Peg10 UTSW 6 4,756,451 (GRCm39) small insertion probably benign
R4983:Peg10 UTSW 6 4,756,451 (GRCm39) small insertion probably benign
R4996:Peg10 UTSW 6 4,756,454 (GRCm39) small insertion probably benign
R4997:Peg10 UTSW 6 4,756,457 (GRCm39) small insertion probably benign
R5015:Peg10 UTSW 6 4,756,453 (GRCm39) small insertion probably benign
R5085:Peg10 UTSW 6 4,755,864 (GRCm39) utr 3 prime probably benign
R5091:Peg10 UTSW 6 4,754,511 (GRCm39) missense probably benign 0.01
R5231:Peg10 UTSW 6 4,756,939 (GRCm39) utr 3 prime probably benign
R5278:Peg10 UTSW 6 4,756,442 (GRCm39) small deletion probably benign
R5364:Peg10 UTSW 6 4,756,128 (GRCm39) utr 3 prime probably benign
R5397:Peg10 UTSW 6 4,756,453 (GRCm39) small insertion probably benign
R5485:Peg10 UTSW 6 4,755,565 (GRCm39) missense probably benign 0.09
R5573:Peg10 UTSW 6 4,755,913 (GRCm39) utr 3 prime probably benign
R5710:Peg10 UTSW 6 4,756,351 (GRCm39) small insertion probably benign
R5710:Peg10 UTSW 6 4,756,350 (GRCm39) small insertion probably benign
R5736:Peg10 UTSW 6 4,754,423 (GRCm39) missense probably benign 0.00
R5865:Peg10 UTSW 6 4,754,375 (GRCm39) missense probably damaging 0.98
R6056:Peg10 UTSW 6 4,756,449 (GRCm39) small insertion probably benign
R6116:Peg10 UTSW 6 4,756,351 (GRCm39) small insertion probably benign
R6129:Peg10 UTSW 6 4,756,449 (GRCm39) small insertion probably benign
R6147:Peg10 UTSW 6 4,754,499 (GRCm39) start gained probably benign
R6171:Peg10 UTSW 6 4,756,449 (GRCm39) small insertion probably benign
R6194:Peg10 UTSW 6 4,756,351 (GRCm39) small insertion probably benign
R6197:Peg10 UTSW 6 4,756,452 (GRCm39) small insertion probably benign
R6207:Peg10 UTSW 6 4,756,449 (GRCm39) small insertion probably benign
R6215:Peg10 UTSW 6 4,756,452 (GRCm39) small insertion probably benign
R6276:Peg10 UTSW 6 4,756,449 (GRCm39) small insertion probably benign
R6281:Peg10 UTSW 6 4,756,449 (GRCm39) small insertion probably benign
R6287:Peg10 UTSW 6 4,756,451 (GRCm39) small insertion probably benign
R6302:Peg10 UTSW 6 4,756,449 (GRCm39) small insertion probably benign
R6393:Peg10 UTSW 6 4,756,452 (GRCm39) small insertion probably benign
R6394:Peg10 UTSW 6 4,756,451 (GRCm39) small insertion probably benign
R6405:Peg10 UTSW 6 4,756,453 (GRCm39) small insertion probably benign
R6421:Peg10 UTSW 6 4,756,449 (GRCm39) small insertion probably benign
R6486:Peg10 UTSW 6 4,756,449 (GRCm39) small insertion probably benign
R6538:Peg10 UTSW 6 4,756,449 (GRCm39) small insertion probably benign
R6668:Peg10 UTSW 6 4,754,502 (GRCm39) missense probably benign 0.01
R6679:Peg10 UTSW 6 4,754,276 (GRCm39) utr 5 prime probably benign
R6685:Peg10 UTSW 6 4,754,738 (GRCm39) missense probably damaging 1.00
R6702:Peg10 UTSW 6 4,756,452 (GRCm39) small insertion probably benign
R6706:Peg10 UTSW 6 4,756,452 (GRCm39) small insertion probably benign
R6747:Peg10 UTSW 6 4,757,137 (GRCm39) utr 3 prime probably benign
R6775:Peg10 UTSW 6 4,756,452 (GRCm39) small insertion probably benign
R6811:Peg10 UTSW 6 4,756,451 (GRCm39) small insertion probably benign
R6823:Peg10 UTSW 6 4,756,431 (GRCm39) small deletion probably benign
R6826:Peg10 UTSW 6 4,756,353 (GRCm39) small insertion probably benign
R6847:Peg10 UTSW 6 4,754,279 (GRCm39) utr 5 prime probably benign
R6861:Peg10 UTSW 6 4,756,351 (GRCm39) small insertion probably benign
R6861:Peg10 UTSW 6 4,756,350 (GRCm39) small insertion probably benign
R6876:Peg10 UTSW 6 4,756,451 (GRCm39) small insertion probably benign
R6891:Peg10 UTSW 6 4,756,449 (GRCm39) small insertion probably benign
R6911:Peg10 UTSW 6 4,756,452 (GRCm39) small insertion probably benign
R6973:Peg10 UTSW 6 4,756,431 (GRCm39) small deletion probably benign
R6990:Peg10 UTSW 6 4,756,451 (GRCm39) small insertion probably benign
R6998:Peg10 UTSW 6 4,756,398 (GRCm39) small deletion probably benign
R7070:Peg10 UTSW 6 4,756,454 (GRCm39) small insertion probably benign
R7120:Peg10 UTSW 6 4,756,398 (GRCm39) small deletion probably benign
R7132:Peg10 UTSW 6 4,756,398 (GRCm39) small deletion probably benign
R7140:Peg10 UTSW 6 4,756,452 (GRCm39) small insertion probably benign
R7189:Peg10 UTSW 6 4,756,431 (GRCm39) small deletion probably benign
R7208:Peg10 UTSW 6 4,756,398 (GRCm39) small deletion probably benign
R7256:Peg10 UTSW 6 4,756,398 (GRCm39) small deletion probably benign
R7260:Peg10 UTSW 6 4,756,398 (GRCm39) small deletion probably benign
R7261:Peg10 UTSW 6 4,756,591 (GRCm39) missense unknown
R7401:Peg10 UTSW 6 4,756,452 (GRCm39) small insertion probably benign
R7409:Peg10 UTSW 6 4,756,398 (GRCm39) small deletion probably benign
R7439:Peg10 UTSW 6 4,756,453 (GRCm39) small insertion probably benign
R7475:Peg10 UTSW 6 4,756,398 (GRCm39) small deletion probably benign
R7483:Peg10 UTSW 6 4,756,451 (GRCm39) small insertion probably benign
R7502:Peg10 UTSW 6 4,756,398 (GRCm39) small deletion probably benign
R7515:Peg10 UTSW 6 4,756,452 (GRCm39) small insertion probably benign
R7520:Peg10 UTSW 6 4,756,796 (GRCm39) missense unknown
R7544:Peg10 UTSW 6 4,756,427 (GRCm39) frame shift probably null
R7571:Peg10 UTSW 6 4,756,082 (GRCm39) missense unknown
R7635:Peg10 UTSW 6 4,754,938 (GRCm39) missense probably damaging 0.99
R7677:Peg10 UTSW 6 4,756,398 (GRCm39) small deletion probably benign
R7697:Peg10 UTSW 6 4,756,453 (GRCm39) small insertion probably benign
R7710:Peg10 UTSW 6 4,756,452 (GRCm39) small insertion probably benign
R7803:Peg10 UTSW 6 4,756,431 (GRCm39) small deletion probably benign
R7816:Peg10 UTSW 6 4,756,453 (GRCm39) small insertion probably benign
R7820:Peg10 UTSW 6 4,756,398 (GRCm39) small deletion probably benign
R7827:Peg10 UTSW 6 4,756,452 (GRCm39) small insertion probably benign
R7861:Peg10 UTSW 6 4,756,431 (GRCm39) small deletion probably benign
R7881:Peg10 UTSW 6 4,756,454 (GRCm39) small insertion probably benign
R7904:Peg10 UTSW 6 4,756,452 (GRCm39) small insertion probably benign
R7915:Peg10 UTSW 6 4,756,451 (GRCm39) small insertion probably benign
R7916:Peg10 UTSW 6 4,756,451 (GRCm39) small insertion probably benign
R7963:Peg10 UTSW 6 4,756,452 (GRCm39) small insertion probably benign
R8016:Peg10 UTSW 6 4,756,451 (GRCm39) small insertion probably benign
R8037:Peg10 UTSW 6 4,756,398 (GRCm39) small deletion probably benign
R8062:Peg10 UTSW 6 4,756,398 (GRCm39) small deletion probably benign
R8081:Peg10 UTSW 6 4,756,452 (GRCm39) small insertion probably benign
R8113:Peg10 UTSW 6 4,756,451 (GRCm39) small insertion probably benign
R8115:Peg10 UTSW 6 4,756,707 (GRCm39) missense unknown
R8140:Peg10 UTSW 6 4,756,113 (GRCm39) missense unknown
R8178:Peg10 UTSW 6 4,756,452 (GRCm39) small insertion probably benign
R8233:Peg10 UTSW 6 4,756,453 (GRCm39) small insertion probably benign
R8239:Peg10 UTSW 6 4,756,452 (GRCm39) small insertion probably benign
R8281:Peg10 UTSW 6 4,756,431 (GRCm39) small deletion probably benign
R8310:Peg10 UTSW 6 4,756,454 (GRCm39) small insertion probably benign
R8312:Peg10 UTSW 6 4,756,452 (GRCm39) small insertion probably benign
R8330:Peg10 UTSW 6 4,756,452 (GRCm39) small insertion probably benign
R8338:Peg10 UTSW 6 4,756,398 (GRCm39) small deletion probably benign
R8354:Peg10 UTSW 6 4,756,452 (GRCm39) small insertion probably benign
R8387:Peg10 UTSW 6 4,756,452 (GRCm39) small insertion probably benign
R8390:Peg10 UTSW 6 4,756,451 (GRCm39) small insertion probably benign
R8408:Peg10 UTSW 6 4,756,453 (GRCm39) small insertion probably benign
R8415:Peg10 UTSW 6 4,756,451 (GRCm39) small insertion probably benign
R8439:Peg10 UTSW 6 4,755,462 (GRCm39) missense possibly damaging 0.58
R8444:Peg10 UTSW 6 4,756,398 (GRCm39) small deletion probably benign
R8463:Peg10 UTSW 6 4,756,453 (GRCm39) small insertion probably benign
R8477:Peg10 UTSW 6 4,756,453 (GRCm39) small insertion probably benign
R8507:Peg10 UTSW 6 4,756,453 (GRCm39) small insertion probably benign
R8552:Peg10 UTSW 6 4,756,452 (GRCm39) small insertion probably benign
R8678:Peg10 UTSW 6 4,756,431 (GRCm39) small deletion probably benign
R8699:Peg10 UTSW 6 4,756,451 (GRCm39) small insertion probably benign
R8700:Peg10 UTSW 6 4,756,451 (GRCm39) small insertion probably benign
R8705:Peg10 UTSW 6 4,756,398 (GRCm39) small deletion probably benign
R8765:Peg10 UTSW 6 4,754,492 (GRCm39) missense unknown
R8824:Peg10 UTSW 6 4,756,451 (GRCm39) small insertion probably benign
R8859:Peg10 UTSW 6 4,756,451 (GRCm39) small insertion probably benign
R8870:Peg10 UTSW 6 4,754,825 (GRCm39) missense probably damaging 0.99
R8909:Peg10 UTSW 6 4,756,451 (GRCm39) small insertion probably benign
R8918:Peg10 UTSW 6 4,756,398 (GRCm39) small deletion probably benign
R8924:Peg10 UTSW 6 4,756,398 (GRCm39) small deletion probably benign
R8925:Peg10 UTSW 6 4,756,452 (GRCm39) small insertion probably benign
R8930:Peg10 UTSW 6 4,756,449 (GRCm39) small insertion probably benign
R8950:Peg10 UTSW 6 4,756,452 (GRCm39) small insertion probably benign
R8960:Peg10 UTSW 6 4,756,449 (GRCm39) small insertion probably benign
R8975:Peg10 UTSW 6 4,756,452 (GRCm39) small insertion probably benign
R8988:Peg10 UTSW 6 4,756,398 (GRCm39) small deletion probably benign
R9046:Peg10 UTSW 6 4,756,452 (GRCm39) small insertion probably benign
R9068:Peg10 UTSW 6 4,756,451 (GRCm39) small insertion probably benign
R9074:Peg10 UTSW 6 4,756,451 (GRCm39) small insertion probably benign
R9088:Peg10 UTSW 6 4,756,453 (GRCm39) small insertion probably benign
R9094:Peg10 UTSW 6 4,756,449 (GRCm39) small insertion probably benign
R9114:Peg10 UTSW 6 4,756,452 (GRCm39) small insertion probably benign
R9116:Peg10 UTSW 6 4,756,452 (GRCm39) small insertion probably benign
R9135:Peg10 UTSW 6 4,756,453 (GRCm39) small insertion probably benign
R9137:Peg10 UTSW 6 4,756,398 (GRCm39) small deletion probably benign
R9139:Peg10 UTSW 6 4,757,128 (GRCm39) missense unknown
R9139:Peg10 UTSW 6 4,756,449 (GRCm39) small insertion probably benign
R9171:Peg10 UTSW 6 4,756,452 (GRCm39) small insertion probably benign
R9173:Peg10 UTSW 6 4,756,451 (GRCm39) small insertion probably benign
R9213:Peg10 UTSW 6 4,756,451 (GRCm39) small insertion probably benign
R9216:Peg10 UTSW 6 4,756,452 (GRCm39) small insertion probably benign
R9229:Peg10 UTSW 6 4,756,398 (GRCm39) small deletion probably benign
R9233:Peg10 UTSW 6 4,756,398 (GRCm39) small deletion probably benign
R9283:Peg10 UTSW 6 4,756,452 (GRCm39) small insertion probably benign
R9328:Peg10 UTSW 6 4,756,398 (GRCm39) small deletion probably benign
R9367:Peg10 UTSW 6 4,756,398 (GRCm39) small deletion probably benign
R9369:Peg10 UTSW 6 4,756,452 (GRCm39) small insertion probably benign
R9405:Peg10 UTSW 6 4,756,398 (GRCm39) small deletion probably benign
R9410:Peg10 UTSW 6 4,756,452 (GRCm39) small insertion probably benign
R9412:Peg10 UTSW 6 4,756,453 (GRCm39) small insertion probably benign
R9421:Peg10 UTSW 6 4,756,398 (GRCm39) small deletion probably benign
R9437:Peg10 UTSW 6 4,756,451 (GRCm39) small insertion probably benign
R9440:Peg10 UTSW 6 4,756,451 (GRCm39) small insertion probably benign
R9460:Peg10 UTSW 6 4,756,452 (GRCm39) small insertion probably benign
R9492:Peg10 UTSW 6 4,756,398 (GRCm39) small deletion probably benign
R9495:Peg10 UTSW 6 4,756,451 (GRCm39) small insertion probably benign
R9500:Peg10 UTSW 6 4,756,871 (GRCm39) missense unknown
R9511:Peg10 UTSW 6 4,756,451 (GRCm39) small insertion probably benign
R9515:Peg10 UTSW 6 4,756,452 (GRCm39) small insertion probably benign
R9576:Peg10 UTSW 6 4,756,398 (GRCm39) small deletion probably benign
R9610:Peg10 UTSW 6 4,756,452 (GRCm39) small insertion probably benign
R9611:Peg10 UTSW 6 4,756,453 (GRCm39) small insertion probably benign
R9611:Peg10 UTSW 6 4,756,452 (GRCm39) small insertion probably benign
R9614:Peg10 UTSW 6 4,756,451 (GRCm39) small insertion probably benign
R9619:Peg10 UTSW 6 4,755,316 (GRCm39) missense probably benign 0.02
R9646:Peg10 UTSW 6 4,756,452 (GRCm39) small insertion probably benign
R9655:Peg10 UTSW 6 4,756,398 (GRCm39) small deletion probably benign
R9673:Peg10 UTSW 6 4,756,452 (GRCm39) small insertion probably benign
R9675:Peg10 UTSW 6 4,756,398 (GRCm39) small deletion probably benign
R9696:Peg10 UTSW 6 4,756,431 (GRCm39) small deletion probably benign
R9749:Peg10 UTSW 6 4,756,398 (GRCm39) small deletion probably benign
R9756:Peg10 UTSW 6 4,756,452 (GRCm39) small insertion probably benign
X0065:Peg10 UTSW 6 4,756,515 (GRCm39) utr 3 prime probably benign
Z1176:Peg10 UTSW 6 4,756,451 (GRCm39) small insertion probably benign
Predicted Primers PCR Primer
(F):5'- TGTTTACAGTGCCACAACCG -3'
(R):5'- ACCTTACAGGGTGGTAAATTCTG -3'

Sequencing Primer
(F):5'- TCAGCATGAGCATCTGCATG -3'
(R):5'- GGTGGTAAATTCTGAATCCAGCC -3'
Posted On 2019-10-24